Team:Lethbridge/Notebook

Lethbridge iGEM

• Project
• Description
• Design
• Experiment
• Database
• Notebook
• Parts
• Safety
• RNAi
• Practices
• Integrated Practices
• Contact
• Interviews
• Literature Review
• Ridealongs
• Protocol
• Sampling
• Results
• Team
• Members
• Collab
• Attribution
• Sponsors
• Achievements

menu

• • Project
    • Description
    • Design
    • Experiments
    • Database
    • Notebook
    • Parts
    • Safety
    • RNAi
• • Practices
    • Integrated Practices
    • Intro
    • Interviews
    • Literature Review
    • Ridealongs
    • Protocol
    • Sampling
• Results
• • Team
    • Members
    • Collaborations
    • Attribution
    • Sponsors
• Achievements

Notebook

The various facets of our lab work were divided between several key areas. Please explore!

Nanopore Microbiome Analysis

Single-domain antibody development system

Nanopore Microbiome Analysis

Date	Experiment
2016/08/16	DNA extraction protocol
2016/08/16	Multiple displacement amplification of EMS - Week #1
2016/08/24	16S rRNA gene amplification from EMS samples (week #4)
2016/08/31	Optimization of PCR amplification using various rDNA gene primer pairs
2016/08/31	Large scale PCR amplification using 16S and 18S rRNA
2016/10/4	DNA extraction - Week #4 samples
2016/10/5	Amplify 1N4, 2N4, 3N4, Pseud., virus control, E. coli control

DNA extraction protocol

2016/08/16

Protocol for the extraction of DNA from samples taken from EMS ride-alongs.

1. Ethanol evaporation for approximately 2 hours on the rotary evaporator on high heat, under vacuum and high speed.
2. Add 400 µl of alkaline lysis buffer (200 mM KOH, 50 mM DTT).
3. Mix by inverting tube several times.
4. Incubate on heat block at 65 °C for 10 minutes.
5. Centrifuge at 17,000 x g for 1 minute.
6. Pipette liquid volume (as much as possible) into new 1.5 mL microcentrifuge tube (~300 µl)
7. Add 1/10 of the volume (~30 µl) of 3 M sodium acetate (pH 5.3) to each tube.
8. Add 5 µl of 0.5% LPA (linear polyacrylamide) carrier to each tube.
9. Add 750 µl of cold 100% ethanol to each tube, mix by inverting and place tubes on ice for approximate 10 minutes.
10. Centrifuge at 17,000 x g for 5 minutes.
11. Remove supernatant.
12. Wash with 500 µl of 70% ethanol and mix gently. Push centrifuge and remove supernatant.
13. Repeat wash step (step 12)
14. Vacuum evaporate the ethanol under high heat for 10 minutes.
15. Resuspend in 20 µl of filtered MilliQ water.

Single Domain Antibody Development System

Date	Experiment
2016/05/01	Transformation of plasmids into NEB5α cells
2016/05/09	Set up of O/N cultures to isolate plasmids for SLIC
2016/05/13	PCR amplification of RNAPα::taget scaffold gBlock
2016/05/18	PCR amplification of pSB1T3 and RNAPα::target for T4 DNA polymerase chewback reaction
2016/05/19	SLIC assembly of pSB1T3-RNAPα::target
2016/05/26	PCR amplification for SLIC assembly of pSB3C5_Cl::Nb_Anti-GFP Nb
2016/06/1	SLIC assembly of pSB3C5_Cl::Nb_Anti-GFP Nb
2016/06/01	Amplification of GFP (BBa_E0040) using oNb52 and oNb47
2016/06/02	Colony PCR of potential pSB3C5_Cl::Nb_Anti-GFP Nb clones
2016/06/05	Screening of pSB1T3_RNAPα::target clones using BglII restriction digest
2016/06/25	Single-domain antibody library cloning
2016/07/25	Restriction digest of single-domain antibody (sdAb) scaffold
2016/08/3	Generation of CDR1-2 library by oligo assembly and PCR
2016/08/4	Generation of CDR3 libraries
2016/08/08	Ligation of CDR1-2 and sdAb scaffold
2016/08/10	CDR3 NgoMIV digestion
2016/08/11	KpnI and NgoMIV digests of sdAb scaffold and CDR1-2
2016/08/16	Ligation PCR of CDR3s and sdAb/CDR1-2
2016/08/18	CloneJet cloning of sdAb scaffold/CDR1-2_CDR3 ligation PCRs
2016/08/31	PCR amplification and overlap extension PCR assembly of sdAb library parts
2016/09/07	Overlap extension PCR assembly of sdAb library
2016/09/07	Overlap extension PCR of sdAb 5' CDR1-2 with CDR3 sdAb 3'
2016/09/26	Scale up PCR amplification of sdAb libraries
2016/09/27	PCR amplification of pSB3C5_Cl::Nb backbone for sdAb library SLIC assembly
2016/09/28	SLIC assembly of sdAb library into pSB3C5_Cl::Nb
2016/09/29	sdAb library SLIC assembly electroporation results
2016/10/07	Colony PCR screening of pSB4K5_pBAD RNAPα
2016/10/12	PCR amplification of pSB3K5 for pBAD-RNAPα and B2HR ver 2-1 cloning
2016/10/13	PCR-amplification optimization of B2HR ver 2-1 gBlock from pJET clone
2016/10/17	PCR-amplification of BioBrick parts for cloning into pSB1C3 and pSB3K5
2016/10/18	Restriction digest of B2HR ver 2.1 and RNAPα pBAD for cloning into pSB1C3 and PSB3K3

Transformation of plasmids into NEB5α cells

2016/12/29

The plasmids obtained from the registry were transformed into NEB5α cells.

1. Resuspend DNA from kit plate in 10 µl of sterile MilliQ water

Plasmid	Well	Kit plate (year)
pSB3K3	6F	Kit plate 4 (2016)
pSB3C5	4D	Kit plate 4 (2015)
pSB1T3	8B	Kit plate 4 (2015)
pSB4K5	6H	Kit plate 4 (2016)

2. Add 1 µl of DNA to high efficiency NEB5α cells
3. Incubate on ice for 30 minutes
4. Heatschok at 42 °C for 45 seconds. Keep reactions on ice for the following 5 minutes
5. Add 400 µl of LB media and incubate at 37 °C for 1 hour
6. Plate 200 µl of each reaction in the LB plates containing the respective antibiotic

Previous Next

PCR amplification of pSB3C5_Cl::Nb and Anti-GFP Nb for SLIC assembly

2016/05/11

To linearize the backbone (pSB3C5_Cl::Nb) use primers BioBrick suffix forward (5' TACTAGTAGCGGCCGCTGCAG 3') and oNb46 (5' CATACTCGAGGCTGCGGCGC 3'). The amplification of anti-GFP Nb (BH-GBP3 gBlock) was done using oNb51 (5' GCGCCGCAGCCTCGAGTATGGATGTGCAACTGCAAGAATCAG 3') and BioBrick suffix reverse (5' CTGCAGCGGCCGCTACTAGTA 3').

Table 1. Reagents and the volumes used to set up various PCR reactions

Reagent	Volume (µl)
2x Phusion MM, HF buffer	25
Forward primer, 10 µM	2.5
Reverse primer, 10 µM	2.5
DNA template (10 ng)	1
MilliQ water	19

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	58	20	30
Extension	72	45	30
Final extension	72	300	1

Previous Next

<

PCR amplification of pSB1T3 and RNAPα::target for SLIC

2016/05/13

The plasmid was linearized using the BioBrick prefix forward (5' GAATTCGCGGCCGCTTCTAGAG 3') and BioBrick reverse suffix, while the gBlock (RNAPα::target) was amplified using BioBrick prefix reverse (5' CTCTAGAAGCGGCCGCGAATTC 3') and BioBrick suffix forward.

Table 1. Reagents and the volumes used to set up various PCR reactions

Reagent	Volume (µl)
2x Phusion MM, HF buffer	25
Forward primer, 10 µM	2.5
Reverse primer, 10 µM	2.5
DNA template (10 ng)	1
MilliQ water	19

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	71.7	20	30
Extension	72	45	30
Final extension	72	300	1

Note: Template used for the amplification of RNAPα::target was the wrong one. Use gBlock of pJET clone in future experiments.

Previous Next

Large scale PCR of pSB1T3 and RNAPα::target scaffold to generate more DNA for chewback reactions.

2016/05/18

The previous PCR did not yield enough DNA to carry out the second step of SLIC, a chewback reaction. In this step, the DNA is made single stranded by taking advantage of the exonuclease activity of T4 DNA polymerase.

Table 1. Reagents and the volumes used to set up various PCR reactions

Reagent	Volume (µl)
5x HF Phusion Buffer	10
Phusion (2U/µl)	1
dNTPs, 10 mM	1
Reverse primer, 10 µM	2.5
Forward primer, 10 µM	2.5
DNA template (10 ng)	1
MilliQ water	32

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	71.7	20	30
Extension	72	45	30
Final extension	72	300	1

Note: Template used for the amplification of RNAPα::target was the wrong one. Use gBlock of pJET clone in future experiments.

Previous Next

SLIC assembly of pSB1T3_RNAPα::target.

2016/05/19

Table 1. Quantification of the purified PCR products using a BioDrop

Sample	[DNA](ng/µl)	A260/280
pSB1T3 SLIC PCR	78.18	1.854
RNAPα::target SLIC PCR	50.24	1.844

Chewbackk reactions of 3' ends using T4 DNA polymerase

Reagent	Volume (µl)
10x NEBuffer 2.1	2
DNA fragments (~ 1000 ng)	16
MilliQ water	0
T4 DNA polymerase (0.3 U/µl)	1
DpnI (10 U/µl)/td>	1

Incubate reactions for 30 minutes in a 37 °C waterbath

Add 2 µl of 10 mM dCTP to arrest the reaction. Inmediately transfer the tubes to an ice box

Assembly of DNA fragments

Fragment	DNA size (bp)	Relative size	Equivalent DNA amount (ng)	[Chewback] (ng/µl)	Amount of chewback needed (µl)
pSB1T3 SLIC PCR	2497	1	1000	60	16
RNAPα::target SLIC PCR	1028	0.41	410	40	10.25

Mix the required DNA amounts in a microcentrifuge tube and incubate for 10 minutes at 37 °C in a waterbath.

Clean up reaction using the BioBasic enzymatic protocol.

Electroporate 100 ng of DNA into fresh electrocompetent E. coli BL21(DE3) gold.

Previous Next

PCR amplification for SLIC assembly of pSB3C5_Cl::Nb_Anti-GFP Nb

2016/05/26

More PCR product is needed to do the chewback reaction. Large scale PCRs were set up for this purpose

Table 1. Reagents and the volumes used to set up various PCR reactions

Reagent	Volume (µl)
2x Phusion MM, HF buffer	75
Reverse primer, 10 µM	7.5
Forward primer, 10 µM	7.5
DNA template (10 ng)	3
MilliQ water	57

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	58	20	30
Extension	72	45	30
Final extension	72	300	1

Previous Next

SLIC assembly of pSB3C5_Cl::Nb_GBP3

2016/06/01

Table 1. Quantification of the purified PCR products using a BioDrop

Sample	[DNA](ng/µl)	A260/280
pSB3C5_Cl::Nb SLIC PCR	274.6	1.849
GBP3 SLIC PCR	178.8	1.829

Chewbackk reactions of 3' ends using T4 DNA polymerase

Reagent	Volume (µl)
10x NEBuffer 2.1	2
DNA fragments (~ 1000 ng)	6
MilliQ water	10
T4 DNA polymerase (0.3 U/µl)	1
DpnI (10 U/µl)/td>	1

Incubate reactions for 30 minutes in a 37 °C waterbath

Add 2 µl of 10 mM dCTP to arrest the reaction. Inmediately transfer the tubes to an ice box

Assembly of DNA fragments

Fragment	DNA size (bp)	Relative size	Equivalent DNA amount (ng)	[Chewback] (ng/µl)	Amount of chewback needed (µl)
pSB3C5_Cl::Nb SLIC PCR	3823	1	1000	50	18
GBP3 PCR	459	0.12	120	50	2.5

Mix the required DNA amounts in a microcentrifuge tube and incubate for 10 minutes at 37 °C in a waterbath

Clean up reaction using the BioBasic enzymatic protocol

Electroporate 100 ng of DNA into fresh electrocompetent E. coli BL21(DE3) gold

Previous Next

Amplification of GFP (BBa_E0040) USING oNb52 and oNb47

2016/06/01

The GFP coding sequence was amplified from pSB2A1 using oNb52 (5' CCAGATCTGCGGCGGCAAGAATCATGCGTAAAGGAGAAGAACTTTTCACTGG 3') and oNb47 (5' GATTCTTGCCGCCGCAGATC 3')

Reagent	Volume (µl)
5x HF Phusion Buffer	4
Phusion (2U/µl)	0.5
dNTPs, 10 mM	0.5
oNb52, 10 µM	1
oNb47, 10 µM	1
pSB2A1 (10 ng)	1
MilliQ water	12

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	X	20	30
Extension	72	45	30
Final extension	72	300	1

A gradient PCR was done to amplify GFP. The thermocycler was set up in a way that each well had a different temperature (51 to 61°C)

The DNA fragments obtained were approximately 750 bp, the expected size of the GFP CDS

Previous Next

Colony PCR of potential pSB3C5_Cl::Nb_GBP3 clones

2016/06/02

The electroporation of the pSB3C5_Cl::Nb_GBP3 was succesful. Each plate had approximately 40 CFU.

Randome colonies were selected to set up colony PCRs using BioBrick suffix reverse and oNb51 as primers, ideally a DNA fragment of the size of the GBP3 gBlock should be observed.

* Using a pipette tip, a little bit of the CFU was mixed with 50 µl of MilliQ water. Only 1 µl of the mixture was added to the PCR tube

Reagent	Volume (µl)
10x Pfu buffer	2
Pfu	0.5
dNTPs, 10 mM	0.5
oNb51, 10 µM	1
BioBrick suffix reverse, 10 µM	1
Colony dilution(*)	1
MilliQ water	14

Table 2. PCR cycle used for the amplification of different DNA fragments

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	120	1
Denaturation	98	30	30
Annealing	58	30	30
Extension	72	30	30
Final extension	72	300	1

The small fragment (~450 bp) belong to the GBP3 gBlock. Indicating that the construct was assembled

The colonies containing the DNA fragment were used to set up O/N cultures. The plasmid was isolated and sent for sequencing

The sequencing results determined that the GBP3 gBlock was not present in any of the plasmids. Repeat SLIC assembly

Previous Next

Screening of potential pSBT3_RNAPα::target clones

2016/06/05

BglII digest of pSB1T3_RNAPα::target clones to determine whether the contruct was assembled.

The RNAPα::target gBlock has a BglII unique cutting site on the 3' of its sequence.

The presence of a single cut indicates a positive clone.

Reagent	Volume (µl)
BglII (ThermoFisher)/td>	1
Buffer O (ThermoFisher)	2
plasmid DNA (100 ng)	5
MilliQ	12

Incubate for 1 hour at 37 °C

Agarose electrophoresis of results.

Clones 8, 9, 11, 12 cut once. The plasmids were sent for sequence analysis

The sequencing results showed that there is a missing region in the RNAPα::target gBlock in the 5' region.

Previous Next

Single domain antibody library (sdAb) scaffold

2016/06/25

Amplification of the sdAb scaffold via PCR

Reagent	Volume (µl)
2x Phusion MM, HF buffer	50
oNb45, 10 µM	5
BioBrick suffix reverse, 10 µM	5
pSB3C5_Cl::Nb (Scaffold) gBlock(10 ng)	1
MilliQ water	39

PCR cycle for the amplification of the sdAb scaffold

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	30	1
Denaturation	98	15	30
Annealing	68	15	30
Extension	72	30	30
Final extension	72	120	1

PCR worked well, however, several larger bands also appeared. They are likely multimers of PCR products as they occur in ~300 bp increments.

The multimers should not affect downstream digestion and cloning steps

Previous Next

Restriction digest of sdAb scaffold

2016/08/02

Double digest of sdAb scaffold PCR using NheI and BamHI

Reagent	Volume (µl)
10x Fast Digest buffer	4
sdAb scaffold PCR (103 ng/µl)	30
NheI Fast Digest (ThermoScientific)	3
BamHI Fast Digest (ThermoScientific)	3

Incubate for 30 minutes at 37 °C

Spin column purification (BioBasic) and elute DNA in 40 µl MilliQ water

Set up NgoMIV difest using the eluted DNA

Reagent	Volume (µl)
10x CutSmart buffer	10
sdAb scaffold PCR (NheI and BamHI digested)	40
NgoMIV (10 U/µl)	2
MilliQ water	48

Incubate for 30 minutes at 37 °C

Spin column purification (BioBasic) and elute DNA in 40 µl MilliQ water

The sample concentration is approximately 64 ng/µl

KpnI digestion of sdAb scaffold

Reagent	Volume (µl)
10x KpnI buffer	10
sdAb scaffold PCR (NheI, BamHI, NgoMIV digest)	40
KpnI (10 U/µl)	2
MilliQ water	48

Incubate for 30 minutes at 37 °C

Spin column purification (BioBasic) and elute DNA in 40 µl MilliQ water

Previous Next

Generation of CR1-2 library by oligo assembly and PCR

2016/08/03

Oligo annealing of CDR1 and Framework region 2

Reagent	Volume (µl)
oNb, 100 µM	2
oNb6, 100 µM	2
MilliQ water	46

Heat oligo mixture to 95°C, then slowly cool on heat block (turn heat block off and let it reach room temperature)

Extend oligos using T4 DNA polymerase

Reagent	Volume (µl)
Annealed oligos (4 µM)	43
10x NEBuffer 2.1,	5
dNTPs, 10 mM	1
t4 DNA polymerase (3 U/µl)	1

Incubate for 30 minutes at 12 °C for 15 minutes on thermocycler, then place on ice, clean up on spin column and elute in 40 µl of MilliQ water

Use 2 µl extended oligos as template for PCR (10 pmol)

PCR amplification of CDR1-2 oligos

Reagent	Volume (µl)
2x Phusion MM, HF buffer	25
Annealed/ Extended oligos (50 pmol)	10
oNb 7, 10 µM	1
MilliQ water	14

Step	Temperature (°C )	Duration (s)	Cycles
Initial denaturation	98	120	1
Denaturation	98	20	5
Annealing	72	20	5
Extension	72	120	1

Generation of CDR3 libraries

2016/08/03

Oligo annealing of various CDR3 DNA fragments

Reagent	Volume (µl)
Forward oligo (oNb8, 9, 10, 11, 12), 100 µM	2
oNb13, 100 µM	2
MilliQ water	46

Heat oligo mixture to 95°C, then slowly cool on heat block (turn heat block off and let it reach room temperature)

Extend oligos using T4 DNA polymerase

Reagent	Volume (µl)
Annealed oligos (4 µM)	43
10x NEBuffer 2.1,	5
dNTPs, 10 mM	1
t4 DNA polymerase (3 U/µl)	1

Incubate for 30 minutes at 12 °C for 15 minutes on thermocycler, then place on ice, clean up on spin column and elute in 40 µl of MilliQ water

Phenol/chloroform extract DNA

\