Team:Missouri Rolla/Notebook

Joe Microbe’s Self-Service Notebook

Many of our standard procedures can be found in our Lab Training Manual. Find more information about our oligos in the inventory.

18 October 2016

Kira Buckowing, Mikayla Tessmer, Bryan Tracy, and Matt Napoli

Start: 5:30pm


Restriction Digests and Gel


Purpose: To check the results from minipreps.

Protocol:


Restriction digests were run using the thermocycler to heat kill after cutting at E and P.
10/18 D1-D8
2.5 μL 10X Tango buffer (2X total)
20.5 μL 10/16 MP1-MP8
1 μL EcorRI
1 μL PstI

LTM Ed. 2 Gel
A 1% agarose gel was run at 130 V for ~45 minutes:
10/18 Gel
1 10 μL 2-log purple DNA ladder
2 10uL 10/18 D1
3 30 μL 10/18 D2
4 30 μL 10/18 D3
5 30 μL 10/18 D4
6 30 μL 10/18 D5
7 30 μL 10/18 D6
8 30 μL 10/18 D7
9 30 μL 10/18 D8
10 10 μL 2-log purple DNA ladder

Stop: 10:00pm



Results:

Sample ng/μL 260/280
10/17 MP1 60.5 1.83
10/17 MP2 27.9 1.73
10/17 MP3 53.9 1.93
10/17 MP4 46.6 1.81
10/17 MP5 63.5 1.83
10/17 MP6 35.2 1.85
10/17 MP7 16.2 1.97
10/17 MP8 77.2 1.72

Products:

 
Label Source Description
10/18 D1 10/17 MP1 Nothing
10/18 D2 10/17 MP2 Nothing
10/18 D3 10/17 MP3 Nothing
10/18 D4 10/17 MP4 Nothing
10/18 D5 10/17 MP5 Nothing
10/18 D6 10/17 MP6 Nothing
10/18 D7 10/17 MP7 Nothing
10/18 D8 10/17 MP8 Nothing

Next:


Nothing

17 October 2016

Kira Buckowing, Paige Deirkes, Kent Gorday, Mikayla Tessmer, Bryan Tracy, and Matt Napoli

Start: 4:45pm


Minipreps


Purpose: To check the results from overnight broth culture growth.

Protocol:


Minipreps were performed using the kitless Merlin protocol, final elutions done with 100uL TE buffer.

Stop: 8:30pm



Products:

 
Label Source Description
10/17 MP1 10/16 BC5 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP2 10/16 BC6 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP3 10/16 BC7 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP4 10/16 BC8 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP5 10/16 BC9 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP6 10/16 BC10 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP7 10/16 BC12 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/17 MP8 10/16 BC13 Hopefully the assembled product of ocimene in the iGEM shipping backbone

Next: Check concentration of miniprep products, then digest and run a gel to check the DNA.


16 October 2016

Kira Buckowing

Start: 12:00pm

Chemical Transformations

Purpose: To check on the most recent work and get the wanted ocimene synthase in a chlor resistance backbone.

Protocol:

HiFi assemblies were set up as per the NEB protocol and incubated in ther thermocylcler for 15 minutes at 50 C.
10/16 HiFi 1
9 uL 10/14 D1
1 uL 10/14 D4
10 uL HiFi Master Mix
10/16 HiFi 2
9 uL 10/14 D2
1 uL 10/14 D4
10 uL HiFi Master Mix
14 broth Cultures were set up from colony growth on the 10/15 chemical transformation plates. Chemical transformations were performed using the chemically competent cells from NEB and adding either 2 uL or 6 uL of the appropriate HiFi assembly product, noted in the products section below.

Stop: 3:30pm

Products:

 
Label Source Description
10/16 CT1 100 uL 10/16 HiFi 1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 2 uL added
10/16 CT1 250 uL 10/16 HiFi 1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 2 uL added
10/16 CT2 100 uL 10/16 HiFi 2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 2 uL added
10/16 CT2 250 uL 10/16 HiFi 2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 2 uL added
10/16 CT3 100 uL 10/16 HiFi 1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 6 uL added
10/16 CT3 250 uL 10/16 HiFi 1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 6 uL added
10/16 CT4 100 uL 10/16 HiFi 2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 6 uL added
10/16 CT4 250 uL 10/16 HiFi 2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone, 6 uL added
10/16 HiFi 1 10/14 D1 and D4 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 HiFi 2 10/14 D2 and D4 Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC1 10/15 CT2 100 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC2 10/15 CT2 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC3 10/15 CT2 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC4 10/15 CT2 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC5 10/15 CT2 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC6 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC7 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC8 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC9 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC10 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC11 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC12 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC13 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone
10/16 BC14 10/15 CT4 250 uL Hopefully the assembled product of ocimene in the iGEM shipping backbone

Next: Minipreps of any growth in the broth cultures and checking the plates to see if anything grows.

15 October 2016

Kira Buckowing

Start: 8:00pm

Chemical Transformations

Purpose: To check on the most recent work and get the wanted ocimene synthase in a chlor resistance backbone.

Protocol:

Chemical transformations were performed using the chemically competent cells from NEB and adding 5 uL of the appropriate ligation product.

Stop: 10:20pm

Products:

 
Label Source Description
10/15 CT1 100 uL 10/14 L1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT1 250 uL 10/14 L1 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT2 100 uL 10/14 L2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT2 250 uL 10/14 L2 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT3 100 uL 10/14 L3 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT3 250 uL 10/14 L3 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT4 100 uL 10/14 L4 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone
10/15 CT4 250 uL 10/14 L4 Chemically transformed plasmid hopefully containing ocimene synthase in the pSB1C3 iGEM shipping backbone

Next: HiFi assembly to cover all bases and give other options for the wanted assembled product and checking the plates to see if anything grows.

14 October 2016

Kira Buckowing

Start: 5:00pm

Gel to verify 10/13 results and Ligations of ocimene and the pSB13C shipping backbone.

Purpose: To check on the most recent work and get the wanted ocimene synthase in a chlor resistance backbone.

Protocol:

LTM Ed. 2 Gel A 1% agarose gel was run at 130 V for ~45 minutes:
10/14 Gel
1 10 μL 2-log purple DNA ladder
2 10/13 1
3 10/13 2
4 10/13 A2
5 10/13 A8
6 10/13 A8
5 10/14 A4
7 10/13 A5
8 10/13 A6
9 10/13 A7
10 10 μL 2-log purple DNA ladder
Digests from 10/11 were NanoDropped to determine concentrations. Restriction digests were prepared, then incubated and heat-killed in the thermocycler:
10/14 D1
2.5 μL MilliQ water
2.5 μL 10X Tango buffer (2X total)
18 μL 10/11 G4
1 μL EcoRI
1 μL PstI
10/14 D2
2.5 μL MilliQ water
2.5 μL 10X Tango buffer (2X total)
18 μL 10/11 G4
1 μL EcoRI
1 μL PstI
10/14 D3
2.5 μL 10X Tango buffer (2X total)
20.5 μL 10/11 G1
1 μL EcoRI
1 μL PstI
10/14 D4
12.5 μL MilliQ water
2.5 μL 10X Tango buffer (2X total)
8 μL pSB13C iGEM Kit DNA
1 μL EcoRI
1 μL PstI
Ligations were set up for combinations of each digested backbone and the two versions of the ocimene synthase gene.
10/14 L1
9 uL 10/14 D1
2 uL 10/14 D3
1 uL Ligase Buffer
1 uL Ligase
10/14 L2
9 uL 10/14 D2
2 uL 10/14 D3
1 uL Ligase Buffer
1 uL Ligase
10/14 L3
9 uL 10/14 D1
2 uL 10/14 D4
1 uL Ligase Buffer
1 uL Ligase
10/14 L4
9 uL 10/14 D2
2 uL 10/14 D4
1 uL Ligase Buffer
1 uL Ligase

Stop: 9:20pm

Results:

Sample ng/μL 260/280
10/11 GE1 16 1.79
10/11 GE3 14.05 1.75
10/11 GE4 12.5 1.74

Products:

 
Label Source Description
10/14 D1 10/11 G4 Ocimene gel extraction digested with E and P
10/14 D2 Ocimene gBlock from IDT ocimene synthase digested with E and P
10/14 D3 10/11 G1 pSB13C backbone digested with E and P
10/11 G4 pBSIC3 from iGEM Kit DNA pSB1C3 shipping backbone digested with E and P
10/11 L1 10/11 D1 and D3 Hopefully ocimene synthase in the iGEM shipping backbone.
10/11 L2 10/11 D2 and D3 Hopefully ocimene synthase in the iGEM shipping backbone.
10/11 L3 10/11 D1 and D4 Hopefully ocimene synthase in the iGEM shipping backbone.
10/11 L4 10/11 D2 and D4 Hopefully ocimene synthase in the iGEM shipping backbone.

Next: Chemical transformations of the ligations to see if anything grows.

13 October 2016

Kent Gorday, Mikayla Tessmer, Bryan Tracy, and Matt Napoli

Start: 4:50 pm

Final amplification of LeupA and LeupB

Purpose: To clone LeupA and LeupB into pSB1C3

Protocol:

Two PCRs were set up and left to react in thermocycler with the same program:
10/13 A1 (9/27 A2, LeupA)
7 μLMilliQ water
10 μL2x Q5 Master Mix
1 μL30 ng 2/25 3
1 μL10 μM oKG42
1 μL10 μM oKG43
20 μL
10/13 A2 (LeupA - control)
8 μLMilliQ water
10 μL2x Q5 Master Mix
1 μL10 μM oKG42
1 μL10 μM oKG43
20 μL
Temperature (°C)Time (s)
9830
98c8
57c22
72c163
72120
4hold

cycle X30

Two more PCRs were set up and left to react in thermocycler with the same program:
10/13 A3 (9/27 A4, LeupB)
7 μLMilliQ water
10 μL2x Q5 Master Mix
1 μL30 ng 2/25 2
1 μL10 μM oKG44
1 μL10 μM oKG45
20 μL
10/13 A4 (LeupB - control)
8 μLMilliQ water
10 μL2x Q5 Master Mix
1 μL10 μM oKG44
1 μL10 μM oKG45
20 μL
Temperature (°C)Time (s)
9830
98c8
57c22
72c45
72120
4hold

cycle X30

Two PCR clean-ups were performed using Macherey-Nagel NucleoSpin kit, eluting with 20 μL buffer. Two more PCRs were set up and left to react in thermocycler with the same program:
10/13 A5 (LeupA + RS)
10 μL2X Q5 Master Mix
8 μL10/13 1
1 μL10 μM oKG4
1 μL10 μM oKG5
20 μL
10/13 A6 (- control)
8 μLMilliQ water
10 μL2X Q5 Master Mix
1 μL10 μM oKG4
1 μL10 μM oKG5
20 μL
Temperature (°C)Time (s)
9830
98c8
62c22
72c160
72120
4hold

cycle X30

Two more PCRs were set up and left to react in thermocycler with the same program:
10/13 A7 (LeupB + RS)
10 μL2X Q5 Master Mix
8 μL10/13 2
1 μL10 μM oKG8
1 μL10 μM oKG9
20 μL
10/13 A8 (- control)
8 μLMilliQ water
10 μL2X Q5 Master Mix
1 μL10 μM oKG8
1 μL10 μM oKG9
20 μL
Temperature (°C)Time (s)
9830
98c8
62c22
72c42
72120
4hold

cycle X30

Stop: 8:00 pm

Products:

LableSourceDescription
10/13 A12/25 3LeupA initially amplified from S. roseus B-3062
10/13 A2LeupA initial amplification negative control
10/13 A32/25 2LeupB initially amplified from S. roseus B-1320
10/13 A4LeupB initial amplification negative control
10/13 A510/13 1LeupA amplified with RFC[10] prefix and suffix
10/13 A6LeupA RFC[10] prefix and suffix primer negative control
10/13 A710/13 2LeupB amplified with RFC[10] prefix and suffix
10/13 A8LeupB RFC[10] prefix and suffix primer negative control
10/13 110/13 A1LeupA initially amplified, PCR Clean-up
10/13 210/13 A3LeupB initially amplified, PCR Clean-up

Next:

Run a gel with 5 μL each: 10/13 1, 10/13 2, 10/13 A2, 10/13 A4, 10/13 A5, 10/13 A6, 10/13 A7, and 10/13 A8

11 October 2016

Kira Buckowing, Kent Gorday, Mikayla Tessmer, Bryan Tracy, and Matt Napoli

Start: 5:00pm

Gel to verify 10/10 results and ocimene gBlock

Purpose: To check on the most recent pSB1C3 backbone digests and the ocimene gBlock from IDT.

Protocol:

LTM Ed. 2 Gel and Gel Extraction A 1% agarose gel was run at 130 V for ~45 minutes:
10/11 Gel
1 10/10 D2
2 10/10 D1
3 10 μL 2-log purple DNA ladder
4 10/10 D3
5 Ocimene gBlock
The bands that showed up in the gel were cut out and gel extractions were performed using the Macherey-Nagel NucleoSpin kit, eluting with 30 μL buffer.

Stop: 8:20pm

Results:

Products:

 
Label Source Description
10/11 G1 10/10 D1 pSB13C backbone
10/11 G2 10/9 D2 pSB13C backbone
10/11 G3 10/9 D3 pSB13C backbone
10/11 G4 Ocimene gBlock ocimene synthase

Notes:

G2 did not dissolve fully in the first step and is probably not a viable product.

Next: NanoDrop for concentrations, then set up appropriate ligations with the ocimene from the gBlock itself and this gel extraction product.

10 October 2016

Kira Buckowing, Bryan Tracy, and Matt Napoli

Start: 6:00pm

Second digest on the 10/9 D1

Purpose: To get the second cut site at S without interference from the first cut site at E done previously.

Protocol:

A restriction digest was prepared, then incubated and heat-killed in the thermocycler:
10/10 D1
20 μL MilliQ water
2.5 μL 10X Tango buffer (2X total)
1.42 μL 10/9 D1
1 μL SpeI

Stop: 8:00pm

Products:

 
Label Source Description
10/10 D1 10/9 D1 pSB13C backbone digested with E and S

Next: Gel to verify products and extractions of the correct digested products.

9 October 2016

Kent Gorday, Mikayla Tessmer, and Bryan Tracy

Start: 11:00 am

 

Protocol:

A 0.7% agarose gel was run at 130 V:
10/9 Gel #1
2 5 μL 2-log purple DNA ladder
3 5 μL 10/8 A1 + 5 μL 10/8 A2
4 5 μL 10/8 A5
5 5 μL 10/8 A6
6 5 μL 10/8 A7
A 0.7% agarose gel was run at 78 V:
10/9 Gel #2
2 5 μL 2-log purple DNA ladder
4 max volume 10/8 A3
6 max volume 10/8 A4
Three PCRs were prepared and reacted with the same thermocycler program:
10/8 A1
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE3
1.25 μL 10 μM oKG4
1.25 μL 10 μM oKG5
25 μL
10/8 A2
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE7
1.25 μL 10 μM oKG4
1.25 μL 10 μM oKG5
25 μL
10/8 A4
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE4
1.25 μL 10 μM oKG4
1.25 μL 10 μM oKG5
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
66c 22
72c 160
72 120
4 hold

cycle X30

Three additional PCRs were prepared and reacted with the same thermocycler program:
10/8 A3
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE4
1.25 μL 10 μM oKG8
1.25 μL 10 μM oKG9
25 μL
10/8 A5
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE3
1.25 μL 10 μM oKG8
1.25 μL 10 μM oKG9
25 μL
10/8 A6
1 μL MilliQ water
5 μL 5X Q5 High GC Enhancer
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE7
1.25 μL 10 μM oKG8
1.25 μL 10 μM oKG9
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
66c 22
72c 42
72 120
4 hold

cycle X30

Three restriction digests were prepared and reacted, then heat killed, in the thermocycler:
10/8 D1
20 μL MilliQ water
2.5 μL 10X Tango buffer
1.42 μL 3/24 MP1
1 μL SpeI
24.92 μL
10/8 D2-3
16.5 μL MilliQ water
5 μL 10X Tango buffer
1.42 μL 3/24 MP1
1 μL EcoRI
1 μL PstI
24.92 μL
 

Notes:

No bands were observed for 10/8 A3-4.

Stop: 6:00 pm

 

Results:


Products:

 
Label Source Description
10/9 A1 10/8 GE3 LeupA with RFC[10] prefix and suffix added
10/9 A2 10/8 GE7 LeupA with RFC[10] prefix and suffix added
10/9 A3 10/8 GE4 LeupB with RFC[10] prefix and suffix added
10/9 A4 10/8 GE4 LeupA with RFC[10] prefix and suffix added
10/9 A5 10/8 GE3 LeupB with RFC[10] prefix and suffix added
10/9 A6 10/8 GE7 LeupB with RFC[10] prefix and suffix added
10/9 D1 3/24 MP1 RFP in pSB1C3 digested SpeI
10/9 D2-3 3/24 MP1 RFP in pSB1C3 digested EcoRI & PstI
 

8 October 2016

Kent Gorday, Mikayla Tessmer, Bryan Tracy, Matt Napoli, and Paige Dierkes

Start: 2:00 pm

 

Protocol:

Three 0.7% agarose gels were run at 78 V:
10/8 Gel #1 (loaded incorrectly)
1 5 μL 2-log purple ladder
3 max volume 10/7 A1
5 max volume 10/7 A2
10/8 Gel #2
1 5 μL 2-log purple DNA ladder
3 max volume 10/7 A1
5 max volume 9/27 A4
10/8 Gel #3
2 5 μL 2-log purple DNA ladder
4 10 μL 3/3 A2
5 gel extractions were performed using the NucleoSpin Gel and PCR Clean-up kit from gels 1, 2, and 3. LeupA appeared as the top band in its lane, while LeupB appeared as the brightest in the middle of its lane. Products were Nanodropped to determine concentration. A gel extraction was performed from gel 3 using an Amicon Ultrafree-DA filter. A 1% agarose gel was run at 130 V:
10/8 Gel #4
2 5 μL 2-log purple DNA ladder
4 max volume 10/8 GE5
6 max volume 10/8 GE6
A 0.7% agarose gel was run at 130 V:
10/8 Gel #5
2 5 μL 2-log purple DNA ladder
4 25 μL 10/8 GE5
6 10 μL 10/8 GE6
A gel extraction 2 PCRs were prepared and run in a thermocycler with the same program:
10/8 A1-2
6 μL MilliQ water
12.5 μL 2X Q5 Master Mix
4 μL 10 ng/μL ociS gblock
1.25 μL 10 μM VF2
1.25 μL 10 μM ociR
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
56c 22
72c 45
72 120
4 hold

cycle X11

2 PCRs were prepared and run in a thermocycler with the same program:
10/8 A3
14 μL MilliQ water
20 μL 2X Q5 Master Mix
2 μL 30 ng/μL 2/25 1
2 μL 10 μM oKG44
2 μL 10 μM oKG45
40 μL
10/8 A4
14 μL MilliQ water
20 μL 2X Q5 Master Mix
2 μL 30 ng/μL 2/25 3
2 μL 10 μM oKG44
2 μL 10 μM oKG45
40 μL
 
Temperature (°C) Time (s)
98 30
98c 8
57c 22
72c 45
72 120
4 hold

cycle X30

2 PCRs were prepared and run in a thermocycler with the same program:
10/8 A5 (LeupA + RS)
6 μL MilliQ water
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE3
1.25 μL 10 μM oKG4
1.25 μL 10 μM oKG5
25 μL
10/8 A6 (LeupA + RS)
6 μL MilliQ water
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE7
1.25 μL 10 μM oKG4
1.25 μL 10 μM oKG5
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
56c 22
72c 160
72 120
4 hold

cycle X26

Another PCR was prepared and run in a thermocycler:
10/8 A7 (LeupB + RS)
6 μL MilliQ water
12.5 μL 2X Q5 Master Mix
4 μL 10/8 GE4
1.25 μL 10 μM oKG8
1.25 μL 10 μM oKG9
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
56c 22
72c 42
72 120
4 hold
   

Results:

 
Sample ng/μL 260/280 260/230
10/8 GE3 3.58 1.79 0.02
10/8 GE4 6.67 1.77 0.42
10/8 GE5 14.32 1.60 0.32
10/8 GE6 17.97 1.25 0.17

Products:

Reset Table
Label Source Description
10/8 GE3 10/7 A1 top band LeupA from S. roseus B-1320
10/8 GE4 9/27 A4 middle bright band LeupB from S. roseus B-1320
10/8 GE5 3/3 A2 RFP positive control for Macherey-Nagel kit
10/8 GE6 3/3 A2 RFP positive control for Amicon filters
10/8 GE7 10/7 A3 top band LeupA from S. roseus ISP-5076
10/8 A1 ociS gblock ociS gblock amplified
10/8 A2 ociS gblock ociS gblock amplified
10/8 A3 2/25 1 LeupB from S. roseus ISP-5076
10/8 A4 2/25 3 LeupB from S. roseus B-3062
10/8 A5 10/8 GE3 LeupA with RFC[10] prefix and suffix added
10/8 A6 10/8 GE7 LeupA with RFC[10] prefix and suffix added
10/8 A7 10/8 GE4 LeupB with RFC[10] prefix and suffix added
 

7 October 2016

Kent Gorday, Mikayla Tessmer, Matt Napoli, Bryan Tracy, and Paige Dierkes

Start: 2:30pm

 

Protocol:

1.2% agarose gel was run:
2 5 μL 2-log purple DNA ladder
4 5 μL 10/6 A1
6 5 μL 10/6 A2
8 5 μL 2-log purple DNA ladder
3 PCRs were set up:
10/7 A1-3
14 μL MilliQ water
20 μL 2X Q5 Master Mix
2 μL 30 ng/μL 2/25 1 (A1), 2 (A2), or 3 (A3)
2 μL 10 μM oKG42
2 μL 10 μM oKG43
40 μL
 
Temperature (°C) Time (s)
98 30
98c 8
57c 22
72c 163
72 120
4 hold

cycle X30

 

Stop: 5:00 pm

 

Results:

Products:

 
Label Source Description
10/7 A1 2/25 1 LeupA from S. roseus B-1320
10/7 A2 2/25 2 LeupA from S. roseus B-3062
10/7 A3 2/25 3 LeupA from S. roseus ISP-5076
 

6 October 2016

Kent Gorday, Bryan Tracy, and Mikayla Tessmer

Start: 9:00 am

 

Protocol:

A 0.8% agarose gel was run at 90 V:
1 5 μL 2-log purple DNA ladder
2 5 μL 10/5 A1
3 5 μL 10/5 A2
4 5 μL 10/5 A3
5 5 μL 10/5 A4
6 5 μL 2-log purple DNA ladder
7 5 μL 10/5 A9
8 5 μL 10/5 A10
9 5 μL 10/5 A11
10 5 μL 10/5 A12
Two PCRs were reacted in the thermocycler for the amplification of ociS:
10/6 A1-2
9 μL MilliQ water
12.5 μL 2X Q5 Master Mix
1 μL 10 ng/μL ociS gblock
1.25 μL 10 μM VF2
1.25 μL 10 μM ociR
25 μL
 
Temperature (°C) TIme (s)
98 30
98c 8
60c 22
72c 44
72 120
4 hold

cycle X11

 

Notes:

10/5 A1-16 were done with mixed LeupA and LeupB primer pairs rather than the proper oKG42/43 (LeupA) and oKG44/45 (LeupB) pairs.

Stop: 11:00 am

 

Results:

Products:

 
Label Source Description
10/6 A1 ociS gblock ociS gblock amplified
10/6 A2 ociS gblock ociS gblock amplified
 

5 October 2016

Kent Gorday, Kurt Studer, Bryan Tracy, and Sam Greaney

Start: 5:30 pm

 

Gradient PCRs of Initial LeupA and LeupB

Purpose: To determine the best PCR conditions for amplifying LeupA and LeupB from the Streptomyces roseus genome

Protocol:

Sixteen PCRs were prepared and reacted with two different thermocycler programs, each containing a gradient for the annealing step:
10/5 A1-A8
8.8 μL MilliQ water
12.5 μL 2X Q5 Master Mix
1.25 μL 37.5 ng 2/25 2
1.25 μL 10 μM oKG42
1.25 μL 10 μM oKG44
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
gradient (A1/A5 63.0, A2/A6 60.6, A3/A7 53.3, A4/A8 51.0)c 22
72c 163
72 120
4 hold

cycle X30

10/5 A9-A16
8.8 μL MilliQ water
12.5 μL 2X Q5 Master Mix
1.25 μL 37.5 ng 2/25 2
1.25 μL 10 μM oKG43
1.25 μL 10 μM oKG45
25 μL
 
Temperature (°C) Time (s)
98 30
98c 8
gradient (A9/A13 63.0, A10/A14 60.6, A11/A15 53.3, A12/A16 51.0)c 22
72c 45
72 120
4 hold

cycle X31

 

Notes:

10/5 A1-A8 were restarted in the thermocycler during the first cycle due to a programming error. 10/5 A9-A16 were accidentally cycled 31 instead of 30 times. The original intention was to run each set of conditions with and without GC Enhancer, but none was added.

Stop: 7:00 pm

 

Products:

 
Label Source Description
10/5 A1-A8 2/25 2 Gradient PCRs of LeupA from S. roseus B-1320 -GCE
10/5 A9-A16 2/25 2 Gradient PCRs of LeupB from S. roseus B-1320 -GCE
 

Next:

Run a gel of 10/5 PCRs, and gel purify LeupA and LeupB

27 September 2016

Kent Gorday

Start: 6:00 pm

 

Gel Electrophoresis of New LeupA and LeupB PCRs

Purpose: To verify success of 9/27 PCRs

Protocol:

A 1% agarose gel was run with each 9/27 PCR:
3 7 μL 2-log purple DNA ladder
4 5 μL 9/27 A1
5 5 μL 9/27 A2
6 5 μL 9/27 A3
7 5 μL 9/27 A4
 

Stop: 7:00 pm

 

Results:

Next:

PCR with 16S primers from 2/25 1 using Q5 to check Q5 Master Mix and the remaining genomic DNA prep, with a negative control for both Q5 and Taq.

27 September 2016

Kent Gorday

Start: 12:15 pm

 

New Initial PCRs of LeupA and LeupB

Purpose: To amplify LeupA and LeupB from the Streptomyces roseus genome

Protocol:

 
9/27 A1
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 3
1 μL 10 μM oKG42
1 μL 10 μM oKG43
20 μL
9/27 A2
7 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 3
1 μL 10 μM oKG42
1 μL 10 μM oKG43
20 μL
 
Temperature (°C) Time (s)
98 30
98c 8
57c 22
72c 163
72 120
4 hold

cycle X30

9/27 A3
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 2
1 μL 10 μM oKG44
1 μL 10 μM oKG45
20 μL
9/27 A4
7 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 2
1 μL 10 μM oKG44
1 μL 10 μM oKG45
20 μL
 
Temperature (°C) Time (s)
98 30
98c 8
57c 22
72c 45
72 120
4 hold

cycle X30

 

Stop: 12:50 pm

 

Products:

 
Label Source Description
9/27 A1 2/25 1 LeupA and flanking region amplified from S. roseus ISP-5076 +GCE
9/27 A2 2/25 1 LeupA and flanking region amplified from S. roseus ISP-5076 -GCE
9/27 A3 2/25 2 LeupB and flanking region amplified from S. roseus B-1320 +GCE
9/27 A4 2/25 2 LeupB and flanking region amplified from S. roseus B-1320 -GCE
 

Next:

Run a gel of 9/27 PCRs, also PCR with 16S primers from 2/25 1 using Q5 to check Q5 Master Mix and the remaining genomic DNA prep, with a negative control for both Q5 and Taq.

24 September 2016

Kent Gorday

Start: 3:00 pm

 

Gel of Initial Leupeptin and 16S PCRs

Purpose: To verify success of 9/23 PCRs

Protocol:

A 0.8% agarose gel was run with 9/23 PCR products:
9/24 Gel
2 5 μL 2-log purple DNA ladder
3 5 μL 9/23 A1
4 5 μL 9/23 A2
5 5 μL 9/23 A3
6 5 μL 9/23 A4
7 5 μL 9/23 A5
8 5 μL 9/23 A6
 

Stop: 4:30 pm

 

Results:

Next:

PCR with 16S primers from 2/25 1 using Q5 to check Q5 Master Mix and the remaining genomic DNA prep, with a negative control for both Q5 and Taq. Try LeupA/B initial PCRs again with a lower annealing temperature (59 °C), with and without GC Enhancer.

23 September 2016

Kent Gorday, Ryan Baumann, Lucas Harper, and Kurt Studer

Start: 2:40 pm

 

Leupeptin and 16S PCR Attempts

Purpose: To amplify LeupA and LeupB from the Streptomyces roseus genome, and verify the presence of genomic DNA in preps from three strains while testing 16S primers

Protocol:

Two PCRs were incubated in a thermocycler after new primers were diluted to 10 μM and templates to 30 ng/μL:
9/23 A1
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 1
1 μL 10 μM oKG42
1 μL 10 μM oKG43
20 μL
9/23 A2
7 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 1
1 μL 10 μM oKG42
1 μL 10 μM oKG43
20 μL
 
Temperature (°C) Time (s)
98 30
98c 8
67c 22
72c 185
72 120
4 hold

cycle X30

Two more PCRs were also reacted in a thermocycler:
9/23 A3
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 2
1 μL 10 μM oKG44
1 μL 10 μM oKG45
20 μL
9/23 A4
7 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 30 ng 2/25 2
1 μL 10 μM oKG44
1 μL 10 μM oKG45
20 μL
 
Temperature (°C) Time (s)
98 30
98c 8
67c 22
72c 45
72 120
4 hold

cycle X30

Two more PCRs were also reacted in a thermocycler:
9/23 A4
8.2 μL MilliQ water
10 μL 2X Taq Master Mix
1 μL 30 ng 2/25 2
1 μL 10 μM 27F
1 μL 10 μM 1492R
20 μL
9/23 A5
8.2 μL MilliQ water
10 μL 2X Taq Master Mix
1 μL 30 ng 2/25 3
1 μL 10 μM 27F
1 μL 10 μM 1492R
20 μL
 
Temperature (°C) Time (s)
95 30
95c 22
49c 40
68c 95
68 300
4 hold

cycle X30

Two broth cultures in ISP medium 1 were inoculated from frozen stock using a sterile pipette tip.

Notes:

No negative control was performed for 16S amplification, so genomic DNA preps cannot conclusively be verified. No ISP-4 or ISP-1 media is left. Some basic information about oKG42-45 is included below:
Oligo Sequence Correct Location Mispriming E-Values
oKG42 cttcacccgaatcgatgctg _1163: 93441 + 0.84, 0.84 +- (both far)
oKG43 gtggtgtgttccgtttcctg _1163: 101101 -
oKG44 caggaaacggaacacaccac _1163: 101082 +
oKG45 gggaaaggtgaccaggaagt _1163: 102794 - 0.069, 0.24, 0.24, etc. ++-- (all far)
 

Stop: 5:00 pm

 

Products:

 
Label Source Description
9/25 A1 2/25 1 LeupA and flanking region amplified from S. roseus ISP-5076 +GCE
9/25 A2 2/25 1 LeupA and flanking region amplified from S. roseus ISP-5076 -GCE
9/25 A3 2/25 2 LeupB and flanking region amplified from S. roseus B-1320 +GCE
9/25 A4 2/25 2 LeupB and flanking region amplified from S. roseus B-1320 -GCE
9/25 A5 2/25 2 Portion of 16S rRNA DNA amplified from S. roseus B-1320
9/25 A6 2/25 3 Portion of 16S rRNA DNA amplified from S. roseus B-3062
9/25 BC1 9/6 S1 S. roseus ISP-5076 from frozen stock
9/25 BC2 9/6 S2 S. roseus B-1320 from frozen stock
 

Next:

Run a gel of PCR products to decide if LeupA and LeupB PCRs should be performed from all strains

6 September 2016

Kent Gorday

2 September 2016

Kent Gorday

 

Culturing of and colony PCR from Streptomyces roseus strains

Purpose: To revive S. roseus strains and amplify LeupB

Protocol:

Twelve colony PCRs were reacted in the thermocycler with the same program:
9/2 A1-A6
70 μL 10 μL 2X Q5 Master Mix
21 μL 3 μL MilliQ water
28 μL 4 μL 5X Q5 High GC Enhancer
7 μL 1 μL 10 μM LeupB_F
7 μL 1 μL 10 μM LeupB_R
swirl or add 1 μL colony or liquid culture template
133 μL 20 μL
9/2 A7-A12
70 μL 10 μL 2X Taq Master Mix
57.4 μL 8.2 μL MilliQ water
2.8 μL 0.4 μL 10 μM LeupB_F
2.8 μL 0.4 μL 10 μM LeupB_R
swirl or add 1 μL colony or liquid culture template
133 μL 20 μL
 
Temperature (°C) Time (s)
95 300
95c 17
61c 25
70c 120
70 300
4 hold

cycle X30

Three streaks were performed onto ISP medium 4 using sterile pipette tips, then three ISP medium 1 tube cultures were similarly inoculated.

Notes:

Plates used for streaking were left warming in incubator and had severely dried out.  

Products:

 
Label Source Description
9/2 BC1 2/21 I1 S. roseus ISP-5076 in ISP m. 1
9/2 BC2 2/21 I2 S. roseus B-1320 in ISP m. 1
9/2 BC3 2/21 I3 S. roseus B-3062 in ISP m. 1
9/2 I1 2/21 I1 S. roseus ISP-5076 on ISP m. 4
9/2 I2 2/21 I2 S. roseus B-1320 on ISP m. 4
9/2 I3 2/21 I3 S. roseus B-3062 on ISP m. 4
9/2 A1 2/21 I1 LeupB amplified by colony PCR from S. roseus ISP-5076
9/2 A2 2/21 I2 LeupB amplified by colony PCR from S. roseus B-1320
9/2 A3 2/21 I3 LeupB amplified by colony PCR from S. roseus B-3062
9/2 A4 8/24 BC1 LeupB amplified by colony PCR from S. roseus ISP-5076
9/2 A5 8/24 BC3 LeupB amplified by colony PCR from S. roseus B-3062
9/2 A6 LeupA_F/R negative control PCR
9/2 A7 2/21 I1 LeupB amplified by colony PCR from S. roseus ISP-5076(Taq)
9/2 A8 2/21 I2 LeupB amplified by colony PCR from S. roseus B-1320(Taq)
9/2 A9 2/21 I3 LeupB amplified by colony PCR from S. roseus B-3062(Taq)
9/2 A10 8/24 BC1 LeupB amplified by colony PCR from S. roseus ISP-5076(Taq)
9/2 A11 8/24 BC3 LeupB amplified by colony PCR from S. roseus B-3062(Taq)
9/2 A12 LeupA_F/R negative control PCR(Taq)
 

Next:

 

24 August 2016

Kent Gorday

Start: 2:30 pm

 

Reviving Streptomyces roseus

Purpose: To amplify LeupA and LeupB directly from S. roseus cultures with lysis in thermocycler and ensure strains of S. roseus remain viable.

Protocol:

Three broth cultures were inoculated from single colonies into ISP media 1 and left to incubate at roughly 26°C, 200 rpm.

Stop: 2:45 pm

 

Products:

 
Label Source Description
8/24 BC1 2/23 I1 S. roseus ISP-5076 in ISP m. 1
8/24 BC2 2/23 I2 S. roseus B-1320 in ISP m. 1
8/24 BC3 2/23 I3 S. roseus B-3062 in ISP m. 1
 

Next:

Prepare 25% glycerol stocks from tube cultures, then use a small volume of cultures as template for PCR of LeupA and LeupB with a lysis step. Also streak strains onto ISP-4 plates.

6 July 2016

Kira Buckowing & Kaelyn Yarbrough

Start: 2:00pm

 

Gradient PCR for LeupB Attempt 3 and Gel to verify results,and old ocimene attempts

Purpose: To try and amplify the LeupB strain around the idea that the previous 5/25 A2 was the closest candidate to what was wanted and to check on the most recent ocimene attempts available.

Protocol:

Five identical PCRs were performed with different annealing temperatures using a block gradient:
7/6 A1-A5
10 μL 2X Q5 Master Mix
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 1/6.3X 2/25 1
1 μL 10 μM LeupB_F
1 μL 10 μM LeupB_R
20 μL
 
Temperature (°C) Time (s)
98 105
98c 10
gradient (A1 67.6, A2 67.9, A3 68.2, A4 68.5, A5 68.7)c 25
72c 47
72 120
4 hold

cycle X32

LTM Ed. 2 Gel A 1% agarose gel was run at 130 V for ~45 minutes:
7/6 Gel
1 9/11 D2 LP
2 10 μL 2-log purple DNA ladder
3 13 μL 7/6 A1
4 13 μL 7/6 A2
5 13 μL 7/6 A3
6 13 μL 7/6 A4
7 13 μL 7/6 A5
8 10 μL 2-log purple DNA ladder
9 9/11 L1 LP

Stop: 5:30pm

 

Results:

Next:

Try the PCR again with 5/25 A2 as the basis for LeupB, checking everything again apparently. Ocimene things need to be completely reworked, as suspected.

30 June 2016

Kira Buckowing & Kaelyn Yarbrough

Start: 11:00am

 

Gradient PCR for LeupB Attempt 2 and Gel to verify results

Purpose: To try and amplify the LeupB strain around the idea that the previous 5/25 A2 was the closest candidate to what was wanted.

Protocol:

Five identical PCRs were performed with different annealing temperatures using a block gradient:
6/30 A1-A5
10 μL 2X Q5 Master Mix
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 1/6.3X 2/25 1
1 μL 10 μM LeupB_F
1 μL 10 μM LeupB_R
20 μL
 
Temperature (°C) Time (s)
98 105
98c 10
gradient (A1 67, A2 67.4, A3 67.6, A4 67.8, A5 68)c 25
72c 47
72 120
4 hold

cycle X32

LTM Ed. 2 Gel A 1% agarose gel was run at 130 V for ~45 minutes:
6/30 Gel
1 10 μL 2-log purple DNA ladder
2 13 μL 6/30 A1
3 13 μL 6/30 A2
4 13 μL 6/30 A3
5 13 μL 6/30 A4
6 13 μL 6/30 A5
7 10 μL 2-log purple DNA ladder

Stop: 2:30pm

 

Results:

Next:

Try the PCR again with 5/25 A2 as the basis for LeupB, using a longer range this time, but noting that the Temps closer to 68 seemed to yield slightly better results.

22 June 2016

Kira Buckowing & Kaelyn Yarbrough

Start: 4:05pm

 

Gel Electrophoresis of 5/16 and 5/25 Gradient PCRs

Purpose: To check the validity of the hopefully amplified LeupA and LeupB strains

Protocol:

LTM Ed. 2 Gel A 1% agarose gel was run at 130 V for ~45 minutes:
6/22 Gel
1 10 μL 2-log purple DNA ladder
2 10 μL 5/25 A1
3 10 μL 5/25 A2
4 10 μL 5/25 A3
5 10 μL 5/25 A4
6 10 μL 2-log purple DNA ladder
7 10 μL 5/16 A1
8 10 μL 5/16 A2
9 10 μL 5/16 A3
10 10 μL 5/16 A4

Stop: 6:15

 

Results:

Next:

Try the PCR again with 5/25 A2 as the basis for LeupB, figure out why LeupA doesn't seem to be working.

25 May 2016

Kent Gorday

Start:

 

Gradient PCR of LeupB and Cultures of GST-tagged hmp

Purpose: To isolate LeupB from Streptomyces roseus and GST-tag hmp for purification

Protocol:

Four identical PCRs were performed with different annealing temperatures using a block gradient:
5/25 A1-A4
10 μL 2X Q5 Master Mix
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 1/6.3X 2/25 1
1 μL 10 μM LeupB_F
1 μL 10 μM LeupB_R
20 μL
 
Temperature (°C) Time (s)
98 105
98c 10
gradient (A1 69, A2 67.7, A3 65.9, A4 64.2)c 25
72c 47
72 120
4 hold

cycle X32

Six broth cultures were inoculated after the addition of 1X ampicillin.

Notes:

5/19 CT1 and CT2 had been left in the incubator for many days and may have been growing contamination. 5/19 CT3 plates showed one possible colony, suggesting poor transformation efficiency.

Stop:

 

Products:

 
Label Source Description
5/25 A1 2/25 1 LeupB amplified from S. roseus ISP-5076
5/25 A2 2/25 1 LeupB amplified from S. roseus ISP-5076
5/25 A3 2/25 1 LeupB amplified from S. roseus ISP-5076
5/25 A4 2/25 1 LeupB amplified from S. roseus ISP-5076
5/25 BC1 5/19 CT1 streak hmp in pGEX4T-1 (GST-tagged) in ampicillin
5/25 BC2 5/19 CT1 streak hmp in pGEX4T-1 (GST-tagged) in ampicillin
5/25 BC3 5/19 CT1 colony hmp in pGEX4T-1 (GST-tagged) in ampicillin
5/25 BC4 5/19 CT2 streak hmp in pGEX4T-1 (GST-tagged) in ampicillin
5/25 BC5 5/19 CT2 streak hmp in pGEX4T-1 (GST-tagged) in ampicillin
5/25 BC6 5/19 CT2 colony hmp in pGEX4T-1 (GST-tagged) in ampicillin
 

Next:

Miniprep and digest broth cultures if they grow, then run a gel to evaluate miniprep products and 5/25 A1-A4. Check BL21 transformation procedure

19 May 2016

Kent Gorday

Start:

 

Assembly of hmp into pGEX4T-1

Purpose: To GST-tag hmp for purification

Protocol:

Two chemical transformations were performed into Zymo Mix & Go 5α. 1.5 µL of each plasmid was mixed with 50 µL aliquots, then immediately plated onto pre-warmed plates. A restriction digest was prepared, then incubated and heat-killed in the thermocycler:
5/19 D1
1.6 μL MilliQ water
3 μL 10X Tango buffer (2X total)
8.6 μL 4/28 MP6
0.9 μL EcoRI
0.9 μL XhoI
15 μL (2 μg)
A 1% agarose gel was run at 100 V, then the single band in lane 5 was extracted using the Gel/PCR DNA Fragment Extraction kit:
5/19 Gel #1
2 5 μL 2-log purple DNA ladder
5 15 μL 5/19 D1
A chemical transformation was performed with 1.5 μL of plasmid in 98.5 μL KCM solution, mixed with 100 μL of competent BL21. Mixture was incubated on ice for 15 minutes, then at room temperature for 25 minutes before plating. Gel-extracted fragment was NanoDropped to determine concentration, but showed no characteristic peak at 260 nm.

Notes:

Zymo Mix & Go 5α now in a third-floor freezer

Stop:

 

Results:

 
Sample ng/μL 260/280 260/230
5/19 GE1 0.8 -0.93 0.17
5/19 GE1 1.5 1.36 0.30
 

Products:

 
Label Source Description
5/19 CT1 5/16 L1 hmp in pGEX4T-1 (GST-tagged) on ampicillin
5/19 CT2 5/16 L2 hmp in pGEX4T-1 (GST-tagged) on ampicillin
5/19 D1 4/28 MP6 pGEX4T-1 digested EcoRI & XhoI
5/19 GE1 5/19 D1 pGEX4T-1 digested EcoRI & XhoI, backbone purified
5/19 CT3 10 pg/μL pUC19 transformation efficiency test using pUC19 on ampicillin
 

Next:

 

16 May 2016

Kent Gorday and Erin Nischwitz

Start: 11:40 am

 

Assembly of hmp in pGEX4T-1 and LeupA Gradient PCRs

Purpose: To GST-tag hmp for purification and characterization, and to amplify LeupA from Streptomyces roseus

Protocol:

Two restriction digests were prepared, then incubated and heat-killed in the thermocycler:
5/16 D1
8.2 μL MilliQ water
3 μL 10X Tango buffer
2.6 μL 4/28 MP6
0.6 μL EcoRI
0.6 μL XhoI
15 μL (1 μg)
5/16 D2
10.2 μL MilliQ water
3 μL 10X Tango buffer
0.6 μL 2/20 A2
0.6 μL EcoRI
0.6 μL XhoI
15 μL
A 1% agarose gel was run at 100 V, then the single band in lane 5 was extracted using the Gel/PCR DNA Fragment Extraction kit:
5/16 Gel #1
2 5 μL 2-log purple DNA ladder
3 5 μL 5/16 D2
5 15 μL 5/16 D1
Four identical PCRs were performed with different annealing temperatures using a block gradient:
5/16 A1-A4
10 μL 2X Q5 Master Mix
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 1/6.3X 2/25 1
1 μL 10 μM LeupA_F_V
1 μL 10 μM LeupA_R
20 μL
 
Temperature (°C) Time (s)
98 105
98c 10
gradient (A1 72, A2 70.5, A3 68.9, A4 67.6)c 25
72c 306
72 120
4 hold

cycle X32

The gel-purified fragment was NanoDropped to determine concentration, then two ligations were incubated at 16 °C:
5/16 L1
1 μL 10X T4 ligase buffer
3.7 μL 5/16 GE1
4.3 μL 5/16 D2
1 μL T4 DNA ligase
10 μL (2:1)
5/16 L2
1 μL 10X T4 ligase buffer
1.5 μL 5/16 GE1
6.5 μL 5/16 D2
1 μL T4 DNA ligase
10 μL (8:1)
A 1% agarose gel was run at 130 V for 40 minutes:
5/16 Gel #2
3 5 μL 2-log purple DNA ladder
4 7.5 μL 5/16 A1
5 7.5 μL 5/16 A2
6 7.5 μL 5/16 A3
7 7.5 μL 5/16 A4
Two chemical transformations were performed with 1.5 μL of plasmid in 98.5 μL KCM solution, mixed with 100 μL of competent BL21. Mixture was incubated on ice for 15 minutes, then at room temperature for 25 minutes before plating.

Notes:

Zymo Mix & Go DH5α no longer in Dr. Simone's freezer

Stop: 9:00 pm

 

Results:

5/16 GE1 was reported as 3.9 μL but showed no characteristic peak.

Products:

 
Label Source Description
5/16 D1 4/28 MP6 pGEX4T-1 digested EcoRI & XhoI
5/16 D2 2/20 A2 hmp with GST-tagging sites digested EcoRI & XhoI
5/16 GE1 5/16 D1 pGEX4T-1 digested EcoRI & XhoI, purified backbone
5/16 A1 2/25 1 LeupA amplified from S. roseus ISP-5076
5/16 A2 2/25 1 LeupA amplified from S. roseus ISP-5076
5/16 A3 2/25 1 LeupA amplified from S. roseus ISP-5076
5/16 A4 2/25 1 LeupA amplified from S. roseus ISP-5076
5/16 L1 5/16 D1, 5/16 D2 hmp in pGEX4T-1 (GST-tagged)
5/16 L2 5/16 D1, 5/16 D2 hmp in pGEX4T-1 (GST-tagged)
5/16 CT1 5/16 L1 hmp in pGEX4T-1 (GST-tagged) on ampicillin
5/16 CT2 5/16 L2 hmp in pGEX4T-1 (GST-tagged) on ampicillin
 

Next:

Locate competent DH5α to retry transformations and perform transformation efficiency test of BL21 if no transformants, otherwise inoculate broth cultures of transformed BL21 and miniprep>digest>gel to screen for the correct plasmid. Retry LeupA amplification without GC Enhancer, under the same program at two differrent annealing temperatures.

29 April 2016

Kent Gorday

Start:

 

Verification of GST-tagged hmp and pGEX4T-1 Minipreps

Purpose: To determine if minipreps of GST-tagged hmp and pGEX4T-1 are the correct products

Protocol:

Seven restriction digests were prepared, then incubated and heat-killed in the thermocycler:
4/29 D1
3 μL 10X Tango buffer (2X total)
5.7 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
5.1 μL 4/28 MP1
15 μL (1 μg)
4/29 D2
3 μL 10X Tango buffer (2X total)
5.8 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
5 μL 4/28 MP2
15 μL (1 μg)
4/29 D3
3 μL 10X Tango buffer (2X total)
7.3 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
3.5 μL 4/28 MP3
15 μL (1 μg)
4/29 D4
3 μL 10X Tango buffer (2X total)
6.8 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
4 μL 4/28 MP4
15 μL (1 μg)
4/29 D5
3 μL 10X Tango buffer (2X total)
6.3 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
4.5 μL 4/28 MP5
15 μL (1 μg)
4/29 D6
3 μL 10X Tango buffer (2X total)
6.5 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
4.3 μL 4/28 MP6
15 μL (1 μg)
4/29 D7
3 μL 10X Tango buffer (2X total)
8.2 μL MilliQ water
0.6 μL EcoRI
0.6 μL XhoI
2.6 μL 4/28 MP7
15 μL (1 μg)
A 1% agarose gel was run at 130 V:
4/29 Gel #1
1 15 μL 4/29 D1
2 15 μL 4/29 D2
3 15 μL 4/29 D3
4 15 μL 4/29 D4
5 7.5 μL 2-log purple DNA ladder
6 15 μL 4/29 D5
7 15 μL 4/29 D6
8 15 μL 4/29 D7
 

Stop:

 

Results:

Products:

 
Label Source Description
4/29 D1 4/28 MP1 religated pGEX4T-1 digested EcoRI & XhoI
4/29 D2 4/28 MP2 religated pGEX4T-1 digested EcoRI & XhoI
4/29 D3 4/28 MP3 hmp in pGEX4T-1 digested EcoRI & XhoI
4/29 D4 4/28 MP4 hmp in pGEX4T-1 digested EcoRI & XhoI
4/29 D5 4/28 MP5 pGEX4T-1 digested EcoRI & XhoI
4/29 D6 4/28 MP6 pGEX4T-1 digested EcoRI & XhoI
4/29 D7 4/28 MP7 pGEX4T-1 digested EcoRI & XhoI
 

Next:

 

28 April 2016

Kent Gorday and Erin Nischwitz

Start:

 

Minipreps of GST-tagged hmp and pGEX4T-1

Purpose: To obtain GST-tagged hmp for purification

Protocol:

Seven minipreps were performed using the kitless miniprep procedure, then products were NanoDropped to determine concentration.

Stop:

 

Results:

 
Sample ng/μL 260/280 260/230
4/28 MP1 195.53 1.90 2.65
4/28 MP2 199.29 1.90 2.68
4/28 MP3 285.32 1.91 2.67
4/28 MP4 251.04 1.90 2.55
4/28 MP5 221.64 1.85 1.99
4/28 MP6 233.73 1.87 1.76
4/28 MP7 384.50 1.87 2.07
 

Products:

 
Label Source Description
4/28 MP1 4/27 BC2 religated pGEX4T-1
4/28 MP2 4/27 BC3 religated pGEX4T-1
4/28 MP3 4/27 BC5 hmp in pGEX4T-1
4/28 MP4 4/27 BC6 hmp in pGEX4T-1
4/28 MP5 4/25 BC1 pGEX4T-1
4/28 MP6 4/25 BC2 pGEX4T-1
4/28 MP7 4/25 BC3 pGEX4T-1
 

Next:

 

27 April 2016

Kent Gorday

Start:

 

Cultures of GST-tagged hmp

Purpose: To obtain GST-tagged hmp for purification

Protocol:

Six broth cultures were inoculated after the addition of 1X ampicillin.

Stop:

 

Products:

 
Label Source Description
4/27 BC1 4/26 CT1 religated pGEX4T-1 in ampicillin
4/27 BC2 4/26 CT1 religated pGEX4T-1 in ampicillin
4/27 BC3 4/26 CT1 religated pGEX4T-1 in ampicillin
4/27 BC4 4/26 CT2 hmp in pGEX4T-1 in ampicillin
4/27 BC5 4/26 CT2 hmp in pGEX4T-1 in ampicillin
4/27 BC6 4/26 CT2 hmp in pGEX4T-1 in ampicillin
 

Next:

 

26 April 2016

Kent Gorday

Start:

 

Religation of pGEX4T-1 and Transformation of pGEX4T-1 and hmp in pGEX4T-1

Purpose: To GST-tag hmp for purification and obtain more pGEX4T-1 for future use

Protocol:

A ligation was mixed and incubated at 16°C:
4/26 L1
0.75 μL 10X T4 ligase buffer
6 μL 10/11 D6
0.75 μL T4 DNA ligase
7.5 μL
Two chemical transformations were performed into 50 μL Zymo Mix & Go 5α, which were plated immediately onto pre-warmed plates.

Stop:

 

Products:

 
Label Source Description
4/26 L1 10/11 D6 religated pGEX4T-1
4/26 CT1 4/26 L1 religated pGEX4T-1 on ampicillin
4/26 CT2 4/19 L2 hmp in pGEX4T-1 on ampicillin
 

Next:

 

25 April 2016

Kent Gorday

Start:

 

Broth Cultures of pGEX4T-1

Purpose: To obtain additional pGEX4T-1 plasmid for future use

Protocol:

Six broth cultures were inoculated after the addition of 1X ampicillin.

Stop:

 

Products:

 
Label Source Description
4/25 BC1 8/2/15 pGEX I18 pGEX4T-1 in ampicillin
4/25 BC2 8/2/15 pGEX I18 pGEX4T-1 in ampicillin
4/25 BC3 8/2/15 pGEX I18 pGEX4T-1 in ampicillin
4/25 BC4 8/2/15 pGEX I19 pGEX4T-1 in ampicillin
4/25 BC5 8/2/15 pGEX I19 pGEX4T-1 in ampicillin
4/25 BC6 8/2/15 pGEX I19 pGEX4T-1 in ampicillin
 

Next:

 

24 April 2016

Kent Gorday



22 April 2016

Kent Gorday



21 April 2016

Kent Gorday

Start: 3:00 pm

 

Purpose: To obtain and verify GST-tagged hmp and diagnose LeupA PCRs

Protocol:

Three minipreps were performed using the kitless miniprep procedure and resuspended in 38 μL 1X TE. Products were NanoDropped to determine concentration. Four restriction digests were mixed, then reacted and heat-killed in the thermocycler:
4/21 D1
7.7 μL MilliQ water
1 μL 10X Tango buffer
0.5 μL 4/19 A1
0.4 μL EcoRI
0.4 μL SpeI
10 μL
4/21 D2
3.2 μL MilliQ water
1 μL 10X Tango buffer
5 μL 4/19 A2
0.4 μL EcoRI
0.4 μL SpeI
10 μL
4/21 D3
6.9 μL MilliQ water
1 μL 10X Tango buffer
1.3 μL 4/21 MP2
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/21 D4
6.1 μL MilliQ water
1 μL 10X Tango buffer
2.1 μL 4/21 MP3
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
 

Notes:

4/20 BC1, 2, and 4 had no growth. 4/21 MP1 was discarded after it was dropped.

Stop: 6:30 pm

 

Results:

 
Sample ng/μL 260/280 260/230
4/21 MP2 752.93 1.87 1.82
4/21 MP3 467.38 1.88 2.25
 

Products:

 
Label Source Description
4/21 MP1 4/18 BC1 pGEX4T-1 (discarded)
4/21 MP2 4/20 BC3 hmp in pGEX4T-1
4/21 MP3 4/20 BC5 hmp in pGEX4T-1
4/21 D1 4/19 A1 LeupA amplification digested EcoRI & SpeI
4/21 D2 4/19 A2 LeupA amplification digested EcoRI & SpeI
4/21 D3 4/21 MP2 hmp in pGEX4T-1 digested EcoRI & XhoI
4/21 D4 4/21 MP3 hmp in pGEX4T-1 digested EcoRI & XhoI
 

Next:

Run a gel of digests

20 April 2016

Kent Gorday

Start: 11:50 pm

 

Broth Cultures of pGEX4T-1 and GST-tagged hmp

Purpose: To obtain pGEX4T-1 and GST-tagged hmp

Protocol:

Five broth cultures were inoculated from plates after the addition of 5 μL 1000X ampicillin. 4/18 BC1 was moved into the refrigerator.

Notes:

There was no growth in 4/18 BC2.

Stop: 1:00 am

 

Products:

 
Label Source Description
4/20 BC1 4/19 CT1 pGEX4T-1 in ampicillin
4/20 BC2 4/19 CT1 pGEX4T-1 in ampicillin
4/20 BC3 4/19 CT2 hmp in pGEX4T-1 (GST-tagged) in ampicillin
4/20 BC4 4/19 CT2 hmp in pGEX4T-1 (GST-tagged) in ampicillin
4/20 BC5 4/19 CT2 hmp in pGEX4T-1 (GST-tagged) in ampicillin
 

Next:

Miniprep 4/18 BC1 and 4/20 BC1-5

19 April 2016

Kent Gorday and Erin Nischwitz

Start: 5:00 pm

 

New PCRs of LeupA and Ligations of hmp in pGEX4T-1

Purpose: To isolate LeupA from Streptomyces roseus strains for cloning, and GST-tag hmp.

Protocol:

Three PCR reactions were mixed without polymerase, denatured for 3 minutes on the thermocycler block at 98 °C, then incubated in the thermocycler after the addition of polymerase:
4/19 A1
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 10 μM LeupA_F_V
1 μL 10 μM LeupA_R
1 μL 1/6.3X 2/25 1
10 μL 2X Q5 Master Mix
20 μL
4/19 A2
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 10 μM LeupA_F_V
1 μL 10 μM LeupA_R
1 μL 1/3.7X 2/25 2
10 μL 2X Q5 Master Mix
20 μL
4/19 A3
3 μL MilliQ water
4 μL 5X Q5 High GC Enhancer
1 μL 10 μM LeupA_F_V
1 μL 10 μM LeupA_R
1 μL 1/8.5X 2/25 3
10 μL 2X Q5 Master Mix
20 μL
 
Temperature (°C) Time (s)
98 30
98c 10
72c 400
72 120
4 hold

cycle X32

Two ligations were mixed and left to react at room temperature for four hours:
4/19 L1
1 µL 10X T4 ligase buffer
7 µL MilliQ water
1 µL 10/11 D6
1 µL T4 DNA ligase
10 µL
4/19 L2
0.5 µL 10X T4 ligase buffer
3.5 µL 2/20 D2
0.5 µL 1/2X 10/11 D6
0.5 µL T4 DNA ligase
5 µL
A 1% agarose gel was run at 100 V until the loading dye reached 2/3 of the gel length:
4/19 Gel #1
2 2 µL 10/11 D6 + 5.5 µL 1X TE buffer
3 5 µL 2-log purple DNA ladder
5 7.5 µL 4/19 A1
7 7.5 µL 4/19 A2
9 7.5 µL 4/19 A3
Two chemical transformations were performed into Zymo Mix & Go 5α. 1.5 µL of each plasmid was mixed with 50 µL aliquots, then incubated for 7 minutes on ice. 200 µL of SOC was added for 45 minutes of outgrowth at 37 °C, then 80 µL of each was plated.

Stop: 9:30 pm

 

Results:

Products:

 
Label Source Description
4/19 A1 2/25 1 LeupA amplified from S. roseus ISP-5076
4/19 A2 2/25 2 LeupA amplified from S. roseus B-1320
4/19 A3 2/25 3 LeupA amplified from S. roseus B-3062
4/19 L1 10/11 D6 Religated pGEX4T-1
4/19 L2 10/11 D6, 2/20 D2 hmp in pGEX4T-1 (GST-tagged)
4/19 CT1 4/19 L1 Religated pGEX4T-1 on ampicillin
4/19 CT2 4/19 L2 hmp in pGEX4T-1 (GST-tagged) on ampicillin
 

Next:

Test pH of autoclaved MilliQ water with High GC Enhancer, inoculate broth cultures and miniprep from transformations, miniprep 4/18 broth cultures, then digest and gel to verify products.

18 April 2016

Kent Gorday

Start: 3:00 pm

 

Cultures of pGEX4T-1

Purpose: to obtain new pGEX4T-1 for GST-tagging hmp

Protocol:

Two broth cultures were inoculated from plates after the addition of 5 μL 1000X ampicillin.

Stop: 4:00 pm

 

Products:

 
Label Source Description
4/18 BC1 8/2/15 I18 pGEX4T-1 in ampicillin
4/18 BC2 8/2/15 I19 pGEX4T-1 in ampicillin
 

Next:

Retry LeupA PCRs with longer denaturing and extension times. Miniprep broth cultures, and retry hmp ligations with 10/11 D6.

15 April 2016

Kent Gorday

Start: 1:20 pm

 

Protocol:

Eight restriction digests were prepared before incubation and heat-kill in the thermocycler:
4/15 D1
7 μL MilliQ water
1 μL 10X Tango buffer
1.2 μL 4/14 MP1
0.4 μL EcoRI
0.4 μL SpeI
10 μL (1 μg)
4/15 D2
6.1 μL MilliQ water
1 μL 10X Tango buffer
2.1 μL 4/14 MP2
0.4 μL EcoRI
0.4 μL SpeI
10 μL (1 μg)
4/15 D3
5.5 μL MilliQ water
1 μL 10X Tango buffer
2.7 μL 4/14 MP3
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/15 D4
6.6 μL MilliQ water
1 μL 10X Tango buffer
1.6 μL 4/14 MP4
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/15 D5
7 μL MilliQ water
1 μL 10X Tango buffer
1.2 μL 4/14 MP5
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/15 D6
6.3 μL MilliQ water
1 μL 10X Tango buffer
1.9 μL 4/14 MP6
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/15 D7
3.8 μL MilliQ water
1 μL 10X Tango buffer
4.4 μL 4/14 MP7
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
4/15 D8
6.9 μL MilliQ water
1 μL 10X Tango buffer
1.3 μL 4/14 MP8
0.4 μL EcoRI
0.4 μL XhoI
10 μL (1 μg)
A 1% agarose gel was run at 90 V until the dye reached 2/3 of the gel length:
1 10 μL 4/15 D1
2 10 μL 4/15 D2
3 5 μL 2-log purple DNA ladder
4 10 μL 4/15 D3
5 10 μL 4/15 D4
6 10 μL 4/15 D5
7 10 μL 4/15 D6
8 5 μL 2-log purple DNA ladder
9 10 μL 4/15 D7
10 10 μL 4/15 D8
 

Stop: 5:30 pm

 

Results:

Products:

 
Label Source Description
4/15 D1 4/14 MP1 LeupA from 3/17 GE2 in pSB1C3 cut EcoRI & SpeI
4/15 D2 4/14 MP2 LeupA from 3/17 GE2 in pSB1C3 cut EcoRI & SpeI
4/15 D3 4/14 MP3 hmp in pGEX4T-1 cut EcoRI & XhoI
4/15 D4 4/14 MP4 hmp in pGEX4T-1 cut EcoRI & XhoI
4/15 D5 4/14 MP5 hmp in pGEX4T-1 cut EcoRI & XhoI
4/15 D6 4/14 MP6 hmp in pGEX4T-1 cut EcoRI & XhoI
4/15 D7 4/14 MP7 hmp in pGEX4T-1 cut EcoRI & XhoI
4/15 D8 4/14 MP8 hmp in pGEX4T-1 cut EcoRI & XhoI
 

Next:

Re-try PCR amplification of LeupB and get a clean amplification of LeupA for digestion, then gel purification and ligation into pSB1C3. Obtain more pGEX4T-1 plasmid, digest then gel extract the backbone before ligating with hmp. Perform new transformations.

14 April 2016

Kent Gorday

Start: 6:45 pm

 

Minipreps of LeupA in pSB1C3 and hmp in pGEX4T-1

Purpose: To miniprep transformants to obtain plasmids and verify their assembly

Protocol:

Eight minipreps were performed from the entire volume of broth culture using the kitless miniprep protocol. Spectrophotometry was used to estimate DNA concentration in the products.

Notes:

4/13 BC3 had no growth and was not miniprepped

Stop: 9:30 pm

 

Results:

 
Sample ng/μL 260/280 260/230
4/14 MP1 840.38 1.90 2.31
4/14 MP2 490.54 1.85 2.25
4/14 MP3 379.14 1.83 2.03
4/14 MP4 654.19 1.89 2.31
4/14 MP5 883.61 1.90 2.35
4/14 MP6 541.91 1.86 2.17
4/14 MP7 229.59 1.90 2.74
4/14 MP8 769.14 1.82 1.56
 

Products:

 
Label Source Description
4/14 MP1 4/13 BC1 LeupA from 3/17 GE2 in pSB1C3
4/14 MP2 4/13 BC2 LeupA from 3/17 GE2 in pSB1C3
4/14 MP3 4/13 BC4 hmp in pGEX4T-1
4/14 MP4 4/13 BC5 hmp in pGEX4T-1
4/14 MP5 4/13 BC6 hmp in pGEX4T-1
4/14 MP6 4/13 BC7 hmp in pGEX4T-1
4/14 MP7 4/13 BC8 hmp in pGEX4T-1
4/14 MP8 4/13 BC9 hmp in pGEX4T-1
 

Next:

Digest miniprep products and run a gel to verify identity

13 April 2016

Kent Gorday, Ryan Baumann, and Erin Nischwitz

Start: 5:00 pm

 

Digests for Verification of LeupA and hmp Transformants

Purpose: To verify the identity of plasmids miniprepped from LeupA and hmp transformants, and amplify LeupB

Protocol:

Two PCR reactions were incubated in the thermocycler:
4/13 A1
3 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 10 μM LeupB_F
1 μL 10 μM LeupB_R
4 μL 5X Q5 High GC Enhancer
1 μL 1/6.3X 2/25 1
20 μL
4/13 A2
 
3 μL MilliQ water
10 μL 2X Q5 Master Mix
1 μL 10 μM LeupB_F
1 μL 10 μM LeupB_R
4 μL 5X Q5 High GC Enhancer
1 μL 1/3.7X 2/25 2
20 μL
 
Temperature (°C) Time (s)
98 30
98c1 7
70-0.5c1 26
72c1 44
98c2 7
62c2 26
72c2 44
72 120
4 hold

cycle1 X16, cycle2 X14 4/13 A2 cracked in the thermocycler and was thrown away

Four restriction digests were mixed then incubated for 1 hour at 37 °C and heat-killed in the thermocycler:
4/13 D1
8 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
12.5 µL 3/14 A1
25 µL
4/13 D2
8 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
12.5 µL 3/12 A2
25 µL
4/13 D3
8.75 µL MilliQ water
1.25 µL 10X Tango buffer
0.5 µL EcoRI
2 µL 4/11 MP4
12.5 µL (500 ng)
4/13 D4
8.75 μL MilliQ water
1.25 μL 10X Tango buffer
0.5 μL XhoI
2 μL 4/11 MP4
12.5 μL (500 ng)
A 1% agarose gel was run at 78 V until the bands reached 2/3 of the gel length:
4/13 Gel #1
2 7.5 μL 4/13 A2
3 5 μL 2-log purple DNA ladder
4 25 μL 4/13 D1
5 25 μL 4/13 D2
6 12.5 μL 4/13 D3
7 12.5 μL 4/13 D4
8 5 μL 2-log purple DNA ladder
5 µL of 1000X chloramphenicol or ampicillin was added to each of nine broth cultures, which were then inoculated from plates by wire loop.

Stop: 1:00 am

 

Results:

Products:

 
Label Source Description
4/13 A1 2/25 1 LeupB amplified from S. roseus ISP-5076
4/13 A2 2/25 2 LeupB amplified from S. roseus B-1320 (discarded)
4/13 D1 3/14 A1 LeupA amplified from S. roseus ISP-5076 digested EcoRI & SpeI
4/13 D2 3/12 A2 LeupA amplified from S. roseus B-1320 digested EcoRI & SpeI
4/13 D3 4/11 MP4 hmp in pGEX4T-1 digested EcoRI
4/13 D4 4/11 MP4 hmp in pGEX4T-1 digested XhoI
4/13 BC1 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/13 BC2 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/13 BC3 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/13 BC4 4/9 CT2 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
4/13 BC5 4/9 CT2 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
4/13 BC6 4/9 CT2 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
4/13 BC7 4/9 CT3 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
4/13 BC8 4/9 CT3 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
4/13 BC9 4/9 CT3 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
 

11 April 2016

Kent Gorday and Erin Nischwitz

Start: 5:00 pm

 

Miniprep, digestion, and gel verification of LeupA in pSB1C3 and GST-tagged hmp

Purpose: To verify assembly of LeupA into pSB1C3 and hmp into pGEX4T-1

Protocol:

Four minipreps were performed using 3 mL of broth culture each under the kitless miniprep protocol. Product concentration was measured with the NanoDrop. Four digestions were mixed and incubated in the thermocycler at 37 °C, then heat-killed:
4/11 D1
19.3 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
1.2 µL 4/11 MP1
25 µL (1.5 µg)
4/11 D2
17.8 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
2.7 µL 4/11 MP2
25 µL (1.5 µg)
4/11 D3
19.1 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
1.4 µL 4/11 MP3
25 µL (1.5 µg)
4/11 D4
14.6 µL MilliQ water
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL XhoI
5.9 µL 4/11 MP4
25 µL (1.5 µg)
  A 1% agarose gel was prepared and run at 120 V for 45 minutes:
4/11 Gel #1
2 5 µL 2-log purple DNA ladder
3 7.5 µL 4/11 D1
4 7.5 µL 4/11 D2
5 7.5 µL 4/11 D3
6 7.5 µL 4/11 D4
  Two ligations were mixed and incubated at room temperature overnight:
4/11 L1
1 µL 10X T4 ligase buffer
1 µL 1/19X 3/26 D2
7 µL 4/10 D1
1 µL T4 DNA ligase
10 µL
4/11 L2
1 µL 10X T4 ligase buffer
1 µL 1/50X 3/26 D2
7 µL 4/10 D2
1 µL T4 DNA ligase
10 µL
 

Stop: 11:30 pm

 

Results:

 
Sample ng/μL 260/280 260/230
4/11 MP1 1333.07 1.91 2.37
4/11 MP2 551.06 1.87 2.32
4/11 MP3 1058.70 1.91 2.32
4/11 MP4 254.90 1.89 2.54

Products:

 
Label Source Description
4/11 MP1 4/10 BC1 LeupA from 3/17 GE2 in pSB1C3
4/11 MP2 4/10 BC2 LeupA from 3/17 GE2 in pSB1C3
4/11 MP3 4/10 BC3 LeupA from 3/17 GE2 in pSB1C3
4/11 MP4 4/10 BC6 hmp in pGEX4T-1
4/11 D1 4/11 MP1 LeupA from 3/17 GE2 in pSB1C3 digested EcoRI & SpeI
4/11 D2 4/11 MP2 LeupA from 3/17 GE2 in pSB1C3 digested EcoRI & SpeI
4/11 D3 4/11 MP3 LeupA from 3/17 GE2 in pSB1C3 digested EcoRI & SpeI
4/11 D4 4/11 MP4 hmp in pGEX4T-1 digested EcoRI & XhoI
4/11 L1 4/10 D1, 3/26 D2 LeupA from 3/17 GE1 in pSB1C3
4/11 L2 4/10 D2, 3/26 D2 LeupA from 3/17 GE3 in pSB1C3
 

10 April 2016

Kent Gorday and Erin Nischwitz

Start: 10:30 am

 

New LeupB PCR

Purpose: to amplify LeupB from Streptomyces roseus

Protocol:

New dilutions of primers were performed, then one PCR was incubated in the thermocycler:
4/10 A1
3 µL MilliQ water
10 µL 2X Q5 Master Mix
1 µL 10 µM LeupB_F
1 µL 10 µM LeupB_R
4 µL 5X Q5 High GC Enhancer
1 µL 1/3.7X 2/25 2
20 µL
 
Temperature (°C) Time (s)
98 30
98c 7
68c 26
72c 44
72 120
4 hold

cycle X30

A 1% agarose gel was prepared and run at 130 V for 45 minutes:
Gel 4/10 #1
3 5 µL 2-log purple DNA ladder
5 7.5 µL 4/10 A1
Six broth cultures were inoculated from plates. Two restriction digests were mixed, incubated, then heat killed in the thermocycler:
4/10 D1
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
20.5 µL 3/17 GE1
25 µL (65.8 ng)
4/10 D2
2.5 µL 10X Tango buffer
1 µL EcoRI
1 µL SpeI
20.5 µL 3/17 GE3
25 µL (31.2 ng)
 

Stop: 10:00 pm

 

Results:

Products:

 
Label Source Description
4/10 A1 2/25 2 LeupB amplified from S. roseus B-1320
4/10 D1 3/17 GE1 LeupA amplified and gel extracted, digested EcoRI & SpeI
4/10 D2 3/17 GE3 LeupA amplified and gel extracted, digested EcoRI & SpeI
4/10 BC1 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/10 BC2 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/10 BC3 4/9 CT1 145 µL (white colony) LeupA from 3/17 GE2 in pSB1C3 in chloramphenicol
4/10 BC4 4/9 CT2 145 µL (independent colony) hmp in pGEX4T-1 in ampicillin
4/10 BC5 4/9 CT2 145 µL (independent colony) hmp in pGEX4T-1 in ampicillin
4/10 BC6 4/9 CT2 145 µL (colony with satellites) hmp in pGEX4T-1 in ampicillin
 

Next:

Re-try LeupB amplification. Miniprep broth cultures, then digest and run a gel to verify product identity.

9 April 2016

Kent Gorday

Start: 9:45 am

 

PCR of LeupB, Ligation and Transformation of LeupA and hmp

Purpose: To isolate LeupB from Streptomyces roseus and clone LeupA and GST-tagged hmp.

Protocol:

Three PCRs were prepared and reacted in the thermocycler:
4/9 A1
3 µL MilliQ water
4 µL 5X Q5 High GC Enhancer
10 µL 2X Q5 Master Mix
1 µL 10 µM LeupB_F
1 µL 10 µM LeupB_R
1 µL 1/6.3X 2/25 1
20 µL
4/9 A2
3 µL MilliQ water
4 µL 5X Q5 High GC Enhancer
10 µL 2X Q5 Master Mix
1 µL 10 µM LeupB_F
1 µL 10 µM LeupB_R
1 µL 1/3.7X 2/25 2
20 µL
4/9 A3
3 µL MilliQ water
4 µL 5X Q5 High GC Enhancer
10 µL 2X Q5 Master Mix
1 µL 10 µM LeupB_F
1 µL 10 µM LeupB_R
1 µL 1/8.5X 2/25 3
20 µL
 
Temperature (°C) Time (s)
98 30
98c 7
69.6c 24
72c 40
72 120
4 hold

cycle X30

A 1% agarose gel was prepared and run at 130 V for 45 minutes:
Gel 4/9 #1
1 5 µL 3/26 D1
2 5 µL 3/26 D2
3 7.5 µL 2-log purple DNA ladder
5 7.5 µL 4/9 A1
7 7.5 µL 4/9 A2
9 7.5 µL 4/9 A3
note: pSB1C3 in lanes 1 and 2 is correct but appears to contain some undigested or single-digested product. Since the two digestions only have EcoRI in common, this could be the culprit, but it should not matter if red colonies (religated) are selected against. No amplifications of LeupB were successful. Two ligations were mixed and reacted at room temperature for 3 hours:
4/9 L1
1 µL 10X T4 ligase buffer
1 µL 1/20X 3/26 D2 (1.1 fmol pSB1C3)
7 µL 3/26 D3 (4.5 fmol LeupA)
1 µL T4 DNA ligase
10 µL
4/9 L2
1 µL 10X T4 ligase buffer
1 µL 1/2X 10/11 D5
7 µL 2/20 D2
1 µL T4 DNA ligase
10 µL
Three chemical transformations were performed into Zymo Mix & Go 5α. 1.4 µL of each plasmid was mixed with 33 µL aliquots, then incubated for 7 minutes on ice. 140 µL of SOC was added for 1 hour of outgrowth at 37 °C, then 145 µL and 14.5 µL were plated.

Stop: 9:30 pm

 

Results:

Products:

 
Label Source Description
4/9 A1 2/25 1 LeupB amplified from S. roseus ISP-5076
4/9 A2 2/25 2 LeupB amplified from S. roseus B-1320
4/9 A3 2/25 3 LeupB amplified from S. roseus B-3062
4/9 L1 3/26 D2, 3/26 D3 LeupA from 3/17 GE2 in pSB1C3
4/9 L2 10/11 D5, 2/20 D2 hmp in pGEX4T-1
4/9 CT1 4/9 L1 LeupA in pSB1C3 on chloramphenicol
4/9 CT2 4/9 L2 hmp in pGEX4T-1 on ampicillin
4/9 CT3 3/1 L1 hmp in pGEX4T-1 on ampicillin
 

Next:

Culture and miniprep non-red colonies of 4/9 CT1, CT2, and CT3. Digest and run a gel to verify product identity.

26 March 2016

Kent Gorday

24 March 2016

Kent Gorday

23 March 2016

Kent Gorday

21 March 2016

Kent Gorday

18 March 2016

Kent Gorday



17 March 2016

Kent Gorday

14 March 2016

Kent Gorday



13 March 2016

Kent Gorday



12 March 2016

Kent Gorday

11 March 2016

Kent Gorday

Start: 1:00 pm

 

PCR Amplification of LeupA

Purpose: To isolate LeupA from the genome of 3 Streptomyces roseus strains.

Protocol:

Three PCRs were prepared and reacted in the thermocycler with the same program:
3/11 A1
9 µL MilliQ water
12.5 µL 2X Q5 Master Mix
1.25 µL 10 µM LeupA_F_Val
1.25 µL 10 µM LeupA_R
1 µL 1/6.3X 2/25 1
25 µL
3/11 A2
9 µL MilliQ water
12.5 µL 2X Q5 Master Mix
1.25 µL 10 µM LeupA_F_Val
1.25 µL 10 µM LeupA_R
1 µL 1/3.7X 2/25 2
25 µL
3/11 A3
9 µL MilliQ water
12.5 µL 2X Q5 Master Mix
1.25 µL 10 µM LeupA_F_Val
1.25 µL 10 µM LeupA_R
1 µL 1/8.5X 2/25 3
25 µL
 
Temperature (°C) Time (s)
98 30
98c 7
72c 204
72 120
4 hold

cycle X30

A 1% agarose gel was run at 130 V for 45 minutes:
Gel 3/11 #1
3 5 µL 2-log purple DNA ladder
4 5 µL 3/11 A1
5 5 µL 3/11 A2
6 5 µL 3/11 A3
note: no bands at the expected 7.3 kbp, strong undesired band in 3/11 A2

Stop: 5:00 pm

 

Results:

Products:

 
Label Source Description
3/11 A1 2/25 1 LeupA amplified from S. roseus ISP-5076
3/11 A2 2/25 2 LeupA amplified from S. roseus B-1320
3/11 A3 2/25 3 LeupA amplified from S. roseus B-3062
 

Next:

Re-try amplification with Q5 High GC Enhancer

4 March 2016

Kent Gorday

Start: 4:00 pm

 

Gel of Part-1 and Positive Control PCRs

Purpose: to verify amplification of Part-1 and Q5 positive control

Protocol:

A 1% agarose gel was run at 130 V for 40 minutes:
3/4 Gel #1
5 10μL 3/3 A1
6 10μL 3/3 A2
7 10μL 2-log purple DNA ladder
 

Stop: 5:50 pm

 

Results:

Next:

 

3 March 2016

Kent Gorday

Start: 10:00 am

 

Part-1 and Positive Control PCRs

Purpose: to amplify Part-1 for verification of its assembly, and test 2X Q5 Master Mix

Protocol:

Two PCR reactions were performed in the thermocycler under the same program:
3/3 A1
7 µL MilliQ water
10 µL 2X Q5 Master Mix
1 µL 10 µM VF2
1 µL 10 µM VR
1 µL 1/10X 3/1 L2
20 µL
3/3 A2
7 µL MilliQ water
10 µL 2X Q5 Master Mix
1 µL 10 µM VF2
1 µL 10 µM VR
1 µL 5 pg/µL RFP construct
20 µL
 
Temperature (°C) Time (s)
98 30
98c 7
65c 20
72c 100
72 120
4 hold

cycle X32

 

Stop: 11:00 am

 

Products:

 
Label Source Description
3/3 A1 3/1 L2 Part-1 assembled, ligated into pBSIC3 and amplified (Q5)
3/3 A2 RFP in pSBB1C3 Positive control of 2X Q5 Master Mix
 

Next:

Run a gel of PCRs, also see Mar. 1.

1 March 2016

Kent Gorday

Start: 8:47 pm

 

Ligation of GST-tagged hmp

Purpose: to purify the hmp protein and verify its mass, also demonstrating GST-tagging for characterization of future proteins.

Protocol:

Two ligations were mixed and left to react at room temperature overnight:
3/1 L1
1 µL 10X T4 buffer
2 µL 10/11 D5
6 µL 2/20 D2
1 µL T4 DNA ligase
10 µL
3/1 L2
1 µL 10X T4 buffer
4.6 µL 8/18 D1
3.4 µL 2/20 D3
1 µL T4 DNA ligase
10 µL

(repeat of 2/20 L1 with longer incubation and more homogeneous T4 buffer)

 

Stop: 9:30 pm

 

Products:

 
Label Source Description
3/1 L1 10/11 D5, 2/20 D2 hmp in pGEX4T-1
3/1 L2 8/18 D1, 2/20 D3 part 1 assembled in pSBIC3
 

Next:

Transform 3/1 L1 (onto amp), purify hmp using GST columns, run a SDS-PAGE gel of GST-tagged hmp, cleaved, uncleaved, or both. Amplify LeupA and LeupB from all three 2/25 extractions. Attempt to amplify 3/1 L2 with VR & VF2, also attempting a Q5 control with these primers/TA

27 February 2016

Kent Gorday

Start: 8:45 am

 

Gibson assembly troubleshooting gel

Purpose: to diagnose Gibson assembly/HiFi master mix failures

Protocol:

A 1% agarose gel was run for 45 min at 130 V:
2/27 Gel #1
4 5 µL 2-log purple DNA ladder
5 10 µL 2/20 HF1
 

Notes:

only the ratio between gblocks is significant because of troubles while loading gel

Stop: 10:00 am

 

Results:

Image J and the ladder were used to estimate band mass and thus moles present:
Band (bp) Mass (ng) Amount (fmol)
850 4.008 7.630
1000 4.928 7.974
1150 4.436 4.835
 

Next:

See Feb. 25 and Feb.20 hmp work.

25 February 2016

Kent Gorday

Start: 5:30 pm

 

S. roseus DNA extractions

Purpose: To obtain chromosomal DNA for amplification from S. roseus and verify amplification of ocimene synthase.

Protocol:

Three glycerol stocks were prepared and left in rm. 206 freezer. 2 mL of each broth culture was used with Machery-Nagel NucleoSpin Microbial DNA kit to produce 100 μL of each chromosomal DNA solution. No proteinase K was used, and products were nanodropped to determine concentration. A 1% agarose gel was run for 40 min at 130 V:
2/25 Gel #1
2 5μL 2-log purple DNA ladder
3 5μL 2/23 A1
 

Stop: 9:10 pm

 

Results:

 
Sample ng/μL 260/280 260/230
2/25 1 56.06 1.95 1.73
2/25 2 33.21 1.86 1.04
2/25 3 75.80 1.92 1.74

Products:

 
Label Source Description
2/25 S1 2/21 BC1 S. roseus ISP-5076 glycerol stock
2/25 S2 2/21 BC2 S. roseus B-1320 glycerol stock
2/25 S3 2/21 BC3 S. roseus B-3062 glycerol stock
2/25 1 2/21 BC1 S. roseus ISP-5076 genomic DNA
2/25 2 2/21 BC2 S. roseus B-1320 genomic DNA
2/25 3 2/21 BC3 S. roseus B-3062 genomic DNA
 

Next:

Amplify LeupA and LeupB from genomic DNA, see Feb. 20 hmp work.

23 February 2016

Kent Gorday

Start: 7:10 pm

 

Ocimene synthase amplification

Purpose: amplify part 3 gblock (ocimene synthase) for cloning into pSB1C3

Protocol:

One PCR was reacted in the thermocycler:
2/23 A1
9 μL MilliQ water
12.5 μL 2X Q5 Master Mix
1.25 μL 10 μM VF2
1.25 μL 10 μM OciR
1 μL Part 3 gblock (small drop diluted)
25 μL
 
Temperature (°C) Time (s)
98 30
98c 7
65c 20
72c 53
72 120
4 hold

cycle X32

 

Stop: 7:40 pm

 

Products:

 
Label Source Description
2/23 A1 Part 3 gblock ocimene synthase amplified by Q5 using VF2 & OciR
 

Next:

See Feb. 20 and Feb. 21, also run a gel of 2/23 A1 (recommended 1% 130 V for 40 min, load 5μL)

23 February 2016

Kent Gorday

Start: 10:00 am

 

Further isolation of Streptomyces roseus

Purpose: To obtain chromosomal DNA from S. roseus strains to clone leupeptin genes from.

Protocol:

Three broth cultures and three isolation plates were inoculated from previous plates.

Stop: 10:45 am

 

Products:

 
Label Source Description
2/23 BC1 2/21 I1 S. roseus ISP-5076 on ISP4
2/23 BC2 2/21 I2 S. roseus B-1320 on ISP4
2/23 BC3 2/21 I3 S. roseus B-3062 on ISP4
2/23 I1 2/21 I1 S. roseus ISP-5076 on ISP4
2/23 I2 2/21 I2 S. roseus B-1320 on ISP4
2/23 I3 2/21 I3 S. roseus B-3062 on ISP4
 

Next:

See Feb. 20 and Feb. 21.

21 February 2016

Kent Gorday

Start: 11:00 am

 

Cultures of Streptomyces roseus

Purpose: To obtain chromosomal DNA from S. roseus strains to clone leupeptin genes from.

Protocol:

Three broth cultures and three isolation plates were inoculated from NRRL ampuoles.

Notes:

BCs incubated in benchtop incubator set to 28°C, actually 25°C. Plates in 30°C stationary.

Stop: 11:40 am

 

Products:

 
Label Description
2/21 BC1 S. roseus ISP-5076 in ISP1 (green cap)
2/21 BC2 S. roseus B-1320 in ISP1 (yellow)
2/21 BC3 S. roseus B-3062 in ISP1 (red)
2/21 I1 S. roseus ISP-5076 on ISP4
2/21 I2 S. roseus B-1320 on ISP4
2/21 I3 S. roseus B-3062 on ISP4
 

Next:

See Feb. 20, also ensure pure cultures, create a stock of each strain, use Dr. Westenberg's chromosomal DNA extraction kit.

20 February 2016

Kent Gorday

Start: 8:00 am

 

Assembly of Part 1, Ocimene Synthase, and GST-tagged hmp

Purpose: To assemble part 1 and ocimene synthase into pSB1C3 for registry submission, transfer hmp into pGEX4T-1 for GST-tag purification, and culture Streptomyces roseus to obtain its chromosomal DNA.

Protocol:

Three PCRs were mixed as below and incubated in the thermocycler with given programs:
2/20 A1
3 µL 5X Q5 Reaction Buffer
6.8 µL MilliQ water
0.75 µL 10 µM VF2
0.75 µL 1/10X 100 µM OciS R Primer
1.2 µL 2.5 mM dNTPs
1 µL Part 3 gblock (tiny drop diluted)
1.5 µL 1/10X Q5 Polymerase
15 µL
 
Temperature (°C) Time (s)
98 30
98c 7
66c 20
72c 45
72 120
4 hold

cycle X32

 
2/20 A2
12.5 µL 2X Taq Master Mix
10.5 µL MilliQ water
0.5 µL 10 µM hmp F Primer 7/2
0.5 µL 10 µM hmp R Primer 7/2
1 µL 1/800X 2/11 KG
25 µL

note: 2/11 KG initially 338.5 ng/µL

Temperature (°C) Time (s)
95 30
95c 23
60c 43
68c 95
68 300
4 hold

cycle X32

 
2/20 A3
12.5 µL 2X Taq Master Mix
10.5 µL MilliQ water
0.5 µL 10 µM VF2
0.5 µL 1/10X 100 µM OciS R Primer
1 µL Part 3 gblock (tiny drop diluted)
25 µL
 
Temperature (°C) Time (s)
95 30
95c 23
51c 43
68c 120
68 300
4 hold

cycle X32

One HiFi assembly reaction was performed with only the four insert fragments of Part 1:
2/20 HF1
10 µL 2X HiFi Master Mix
2.1 µL Part 1-1 gblock
2.5 µL Part 1-2 gblock
2.5 µL Part 1-3 gblock
2.9 µL Part 1-4 gblock
20 µL
note: roughly 0.4045 pmol of each 50 °C for 60 minutes in thermocycler A 1% agarose gel was run at 130 V for 45 minutes:
Gel 2/20 #1
2 5 µL 2-log purple DNA ladder
4 5 µL 2/20 A1
6 5 µL 2/20 A2
note: 2/20 A2 yielded a strong band near ~1.3kbp expected product, 2/20 A1 gave no coherent product Three restriction digests were mixed and incubated at 37 °C for 60 minutes before a 20 minute heat kill at 80 °C in thermocycler:
2/20 D1
2.5 µL 10X Tango Buffer
20 µL MilliQ water
1 µL EcoRI
1 µL PstI
0.5 µL 2/20 A3
25 µL
2/20 D2
2.5 µL 10X Tango Buffer
20 µL MilliQ water
1 µL EcoRI
1 µL XhoI
0.5 µL 2/20 A2
25 µL
2/20 D3
2.5 µL 10X Tango Buffer
10.5 µL MilliQ water
1 µL EcoRI
1 µL PstI
10 µL 2/20 HF1
25 µL
note: 2/20 D3 should be roughly 20 ng/µL, 10/11 D5 is ~117.3 ng/µL, 8/18 D1 is 20.5 ng/µL Two ligations were mixed and incubated at room temperature for 40 minutes:
2/20 L1
1 µL 10X T4 Ligase Buffer
4.6 µL 8/18 D1
3.4 µL 2/20 D3
1 µL T4 DNA Ligase
10 µL
2/20 L2
1 µL 10X T4 Ligase Buffer
5 µL 8/18 D1
3 µL 2/20 D1
1 µL T4 DNA Ligase
10 µL
note: 2/20 L1 should be roughly 2 mol pSB1C3 : 1 mol Part 1 and 2.12 ng/µL Two additional PCRs were performed with the same program below:
Temperature (°C) Time (s)
95 30
95c 23
51c 43
68c 250
68 300
4 hold
cycle X32  
2/20 A4
12.5 µL 2X Taq Master Mix
10.5 µL MilliQ water
0.5 µL 10 µM VF2
0.5 µL 10 µM VR
1 µL 1/30X 2/20 L1
25 µL
2/20 A5
12.5 µL 2X Taq Master Mix
10.5 µL MilliQ water
0.5 µL 10 µM VF2
0.5 µL 10 µM VR
1 µL 1/30X 2/20 L2
25 µL
Another 1% agarose gel was run at 130 V for 45 minutes:
Gel 2/20 #2
2 5 µL 2-log purple DNA ladder
3 5 µL 10/11 D5
4 5 µL 2/20 A3
5 10 µL 2/20 D1
6 10 µL 2/20 D2
7 5 µL 2/20 A4
8 5 µL 2/20 A5
note: good pGEX4T-1 band in 3, nothing notable in 4-5 good hmp band in 6, smears in 7-8 Additionally, two media were prepared and autoclaved for culturing Streptomyces roseus:
Trace Salts Solution
0.1 g/100 mL FeSO4 ⋅ 7H2O
0.1 g/100 mL MnCl2 ⋅ 4H2O
0.1 g/100 mL ZnSO4 ⋅ 7H2O
Tryptone - Yeast Extract (ISP1)
5 g/L Tryptone
3 g/L Yeast Extract
pH 7.0 to 7.2
Synthetic Salts - Starch Medium (ISP4/NRRL9)
10 g/L Soluble Starch (corn starch)
1 g/L K2HPO4
1 g/L MgSO4 ⋅ 7H2O
1 g/L NaCl
2 g/L (NH4)2SO4
2 g/L CaCO3
1 mL/L Trace Salts Solution
15 g/L Agar

Stop: 3:30 am

 

Results:

 

#1

#2

Products:

 
Label Source Description
2/20 A1 Part 3 gblock ocimene synthase amplified by Q5 with VF2&ociR
2/20 A2 2/11 KG sequenced hmp with EcoRI & XhoI added
2/20 A3 Part 3 gblock ocimene synthase amplified by Taq
2/20 A4 2/20 L1 verification of Part 1 in pSB1C3 with VF2&VR
2/20 A5 2/20 L2 verification of OciS in pSB1C3 with VF2&VR
2/20 HF1 Part 1-1, 1-2, 1-3, 1-4 gblocks Part 1 insert assembled
2/20 D1 2/20 A3 OciS insert digested E&P
2/20 D2 2/20 A2 hmp with sites added digested EcoRI & XhoI
2/20 D3 2/20 HF1 Part 1 insert digested E&P
2/20 L1 8/18 D1, 2/20 D3 Part 1 in pSB1C3
2/20 L2 8/18 D1, 2/20 D1 OciS in pSB1C3
 

Next:

Ligate 10/11 D5 and 2/20 D2 together, transform and harvest GST-hmp fusion protein for column purification, claving, and SDS-PAGE. Retry amplification of OciS using 2X Q5 Master Mix, and consider ordering primers for the insert of Part 1 to diagnose HiFis. Inoculate cultures of Streptomyces roseus strains and obtain chromosomal DNA.