Generally, the project design can be divided into two portions:
- CRISPR/Cas9system
- LACE system
CRISPR/Cas9 gRNA Design
With different target loci have been tested by the usage of a GFP reporter plasmid (pCold-1) with a CSPA promotor. The target sites can be determined by directing the gRNA consisting of 20 bp length against the desired sequence of interest. F2 gRNA with target sites at different distances to the promotor regions proved successfully as potential activation sites (see Table 1 and Figure 1).
| Name | Binding Site | Distance to promoter | Sequence | Position |
| F1 | CSPA promoter | 15 | TGCATCACCCGCCAATGCG | sense sequences |
| F2 | non-coding | 68 | GCCGCCGCAAGGAATGGTG | sense sequences |
| R1 | CSPA promoter | 43 | ATTAATCATAAATATGAAA | antisense sequences |
| R2 | non-coding | 94 | CATCATCCAACTCCGGCAAC | antisense sequences |
Table 1: Overview of the tested gRNAs with different binding sites on the GFP pCold-1 plasmid.
Figure 1: Position of the target loci on the GFP pCold-1 plasmid.
LACE system
Optogenetic systems enable precise spatial and temporal control of cell behavior. We engineered a light-activated CRISPR/Cas9 effector (LACE) system that induces transcription of endogenous genes in the presence of blue light. This was accomplished by fusing the light-inducible heterodimerizing proteins CRY2 and CIB1 to a transactivation domain and the catalytically inactive tCas9, respectively. The versatile LACE system can be easily directed to new DNA sequences for the dynamic regulation of endogenous genes.
To regulate DNA transcription by blue light, the system is based on CRY2/CIBN interaction in which a light-mediated protein interaction brings together two protein (tCas9 and an activation domain VP64). If we remove the stimulation of blue light, dark reversion of CRY2 will dissociate the interaction with CIBN and shut off transcription.
Figure 2: Schematic diagram
tCas9-CIBN (Prokaryotic LACE system)
The NEU-China iGEM team 2016 designed a fusion protein consisting of tCas9 and CIBN for sequence-specific transactivation of a desired target locus (more information). We used our double truncated tCas9 (BBa_K1982001) impaired in its cleavage activity and fused it to the CIBN (BBa_K1982003). An prokaryotic RBS sequence from the Community collection (BBa_B0034) fused to the beginning of tCas9-CIBN. For detection of expression the fusion protein was tagged with a HA-epitope coding sequence (BBa_K1150016) .
Figure 3: Construct design
tCas9 was fused to CIBN. The resulting fusion construct was flanked by RBS sequences and tagged by a HA epitope. The pBad/araC promoter and rrnB T1 terminator were chosen to control gene expression.
CRY2-VP64(Prokaryotic LACE system)
We used the full-length CRY2 (BBa_K1982002) and fused it to the transcription activator domain VP64 (BBa_K1982012). An prokaryotic RBS sequence from the Community collection(BBa_B0034) fused to the beginning of CRY2-VP64. For detection of expression the fusion protein was tagged with a FLAG-epitope coding sequence (gactacaaggacgacgacgacaaa).
Figure 4: illustrates the detailed design of the this device
tCas9-Vp64(optogenetic control)
To address these limitations, we adapted the CRISPR/Cas9 activator system for optogenetic control. We constructed tCas9-VP64 chimeric constructs gene with an prokaryotic RBS sequence from the Community collection(BBa_B0034). For detection of expression the fusion protein was tagged with a FLAG-epitope coding sequence (gactacaaggacgacgacgacaaa).
Figure 5: illustrates the detailed design of the this device
