Team:TU-Eindhoven/Results/Tetramer

iGEM TU Eindhoven

Tetramer
Tetramer

In order to experimentally test our tetramer we designed several assays, for more information see our experiments page.

We aimed to express and experimentally test our tetramer, but due to some difficulties with cloning we did not manage this in time. However, we managed to successfully create two tetramer constructs in a pET28a vector, namely a homotetramer and a heterotetramer (figure 2). Both constructs are confirmed by

sequencing

Homotetramer
ACCGGTGGCTCTGGGGCTAGCATGGCTGTGGCTCCTACTGCGCGCGAGGAAAACGTTTACATGGCGAAGCTG GCAGAACAAGCAGAGCGCTACGAGGAAATGGTGGAATTTATGGAAAAAGTGAGCAACAGTCTTGGTTCAGA GGAACTTACGGTGGAAGAACGTAATCTCCTGTCCGTTGCCTATAAGAATGTGATTGGAGCACGTCGTGCAAGC TGGCGTATAATCAGTTCGATCGAGCAGAAGGAGGAATCCCGTGGGAATGAGGAGCATGTAAATTCTATTCGC GAATACCGTTCTAAAATTGAAAATGAACTCAGTAAGATTTGTGACGGCATCCTGAAGTTGCTTGATGCCAAGC TGATCCCATCTGCTGCAAGCGGTGACTCTAAAGTGTTCTACTTAAAGATGAAAGGAGACTATCATCGTTACTTG GCTGAGTTTAAGACGGGTGCGGAACGGAAGGAAGCTGCAGAATCTACTCTTACTGCTTACAAGGCTGCCCAG GACATTGCTACTACAGAGTTAGCCCCAACTCACCCCATTCGACTGGGATTGGCTTTAAACTTTTCTGTCTTTTAT TATGAAATCCTTAACAGCCCTGATCGCGCCTGCAACCTTGCGAAACAAGCCTTCGATGAGGCAATAGCTGAAT TGGATACATTAGGCGAAGAGAGTTACAAAGATTCAACTCTGATCATGCAGCTTTTACGTGATAATCTGACTTTA TGGACAAGCGATATGCAAGGTGGTAGTGGTGGATCTGGAGGGTCCGGCGGTTCCGGTGGTAGTGGTGGCTC TGGGGGTAGCGGCGGTAGCGGTGGGTCTGGCGGTAGTATGGCGGTTGCACCTACGGCACGTGAAGAGAATG TGTATATGGCAAAGCTCGCAGAGCAGGCTGAAAGGTATGAAGAGATGGTTGAGTTCATGGAGAAGGTTTCCA ATTCCCTTGGCAGCGAAGAGCTTACCGTCGAGGAGCGCAACCTGCTCAGTGTCGCATACAAAAACGTCATCGG TGCGAGAAGGGCCTCGTGGCGGATTATTTCAAGCATTGAACAAAAAGAAGAGAGTAGAGGCAACGAAGAAC ACGTTAACAGCATCCGGGAGTACCGCAGTAAGATCGAGAACGAACTTTCTAAAATCTGCGATGGGATTTTAAA ACTGCTCGACGCAAAACTTATACCTAGCGCCGCATCAGGCGATAGTAAGGTTTTCTATCTGAAGATGAAGGGA GATTATCACCGATATCTGGCTGAATTCAAGACCGGGGCTGAGCGCAAAGAGGCGGCTGAGAGTACGCTCACG GCCTATAAAGCCGCTCAAGATATCGCAACGACTGAACTTGCACCAACGCATCCTATCCGGCTTGGCCTGGCGC TTAATTTCAGCGTGTTCTACTACGAGATATTGAATTCTCCAGACCGTGCTTGTAATCTGGCTAAGCAGGCGTTT GACGAAGCTATTGCCGAGCTGGACACGCTGGGGGAGGAATCTTATAAGGACAGCACCTTGATTATGCAACTG CTTCGAGACAACCTCACCCTCTGGACCTCTGACATGCAGGGTACCACTAGTGGCGGGAGTGGCGGTAGCGGA GGTTCTGGCGGCAGTGATGACGTGACCCCTTGTAGCATGTCTGGTGGCTCAGGTGGAAGCGAAAACCTGTAT TTCCAGTCCGGTGGCTCTGGTGGAAGCGGCGGATCCGGAGGGAGCGGTGGTTCCGGTGGCTCGGGCGGATC CGGGGGCAGCGGAGGTAGTGGTGGCTCAGGTGGTCTCCTGGCTGTGGCTCCTACTGCGCGCGAGGAAAACG TTTACATGGCGAAGCTGGCAGAACAAGCAGAGCGCTACGAGGAAATGGTGGAATTTATGGAAAAAGTGAGC AACAGTCTTGGTTCAGAGGAACTTACGGTGGAAGAACGTAATCTCCTGTCCGTTGCCTATAAGAATGTGATTG GAGCACGTCGTGCAAGCTGGCGTATAATCAGTTCGATCGAGCAGAAGGAGGAATCCCGTGGGAATGAGGAG CATGTAAATTCTATTCGCGAATACCGTTCTAAAATTGAAAATGAACTCAGTAAGATTTGTGACGGCATCCTGAA GTTGCTTGATGCCAAGCTGATCCCATCTGCTGCAAGCGGTGACTCTAAAGTGTTCTACTTAAAGATGAAAGGA GACTATCATCGTTACTTGGCTGAGTTTAAGACGGGTGCGGAACGGAAGGAAGCTGCAGAATCTACTCTTACTG CTTACAAGGCTGCCCAGGACATTGCTACTACAGAGTTAGCCCCAACTCACCCCATTCGACTGGGATTGGCTTTA AACTTTTCTGTCTTTTATTATGAAATCCTTAACAGCCCTGATCGCGCCTGCAACCTTGCGAAACAAGCCTTCGAT GAGGCAATAGCTGAATTGGATACATTAGGCGAAGAGAGTTACAAAGATTCAACTCTGATCATGCAGCTTTTAC GTGATAATCTGACTTTATGGACAAGCGATATGCAAGGTGGTAGTGGTGGATCTGGAGGGTCCGGCGGTTCCG GTGGTAGTGGTGGCTCTGGGGGTAGCGGCGGTAGCGGTGGGTCTGGCGGTAGTATGGCGGTTGCACCTACG GCACGTGAAGAGAATGTGTATATGGCAAAGCTCGCAGAGCAGGCTGAAAGGTATGAAGAGATGGTTGAGTT CATGGAGAAGGTTTCCAATTCCCTTGGCAGCGAAGAGCTTACCGTCGAGGAGCGCAACCTGCTCAGTGTCGC ATACAAAAACGTCATCGGTGCGAGAAGGGCCTCGTGGCGGATTATTTCAAGCATTGAACAAAAAGAAGAGAG TAGAGGCAACGAAGAACACGTTAACAGCATCCGGGAGTACCGCAGTAAGATCGAGAACGAACTTTCTAAAAT CTGCGATGGGATTTTAAAACTGCTCGACGCAAAACTTATACCTAGCGCCGCATCAGGCGATAGTAAGGTTTTC TATCTGAAGATGAAGGGAGATTATCACCGATATCTGGCTGAATTCAAGACCGGGGCTGAGCGCAAAGAGGCG GCTGAGAGTACGCTCACGGCCTATAAAGCCGCTCAAGATATCGCAACGACTGAACTTGCACCAACGCATCCTA TCCGGCTTGGCCTGGCGCTTAATTTCAGCGTGTTCTACTACGAGATATTGAATTCTCCAGACCGTGCTTGTAAT CTGGCTAAGCAGGCGTTTGACGAAGCTATTGCCGAGCTGGACACGCTGGGGGAGGAATCTTATAAGGACAGC ACCTTGATTATGCAACTGCTTCGAGACAACCTCACCCTCTGGACCTCTGACATGCAGGGTACCTGA

Heterotetramer
ACCGGTGGCTCTGGGGCTAGCATGGCTGTGGCTCCTACTGCGCGCGAGGAAAACGTTTACATGGCGAAGCTG GCAGAACAAGCAGAGCGCTACGAGGAAATGGTGGAATTTATGGAAAAAGTGAGCAACAGTCTTGGTTCAGA GGAACTTACGGTGGAAGAACGTAATCTCCTGTCCGTTGCCTATAAGAATGTGATTGGAGCACGTCGTGCAAGC TGGCGTATAATCAGTTCGATCGAGCAGAAGGAGGAATCCCGTGGGAATGAGGAGCATGTAAATTCTATTCGC GAATACCGTTCTAAAATTGAAAATGAACTCAGTAAGATTTGTGACGGCATCCTGAAGTTGCTTGATGCCAAGC TGATCCCATCTGCTGCAAGCGGTGACTCTAAAGTGTTCTACTTAAAGATGAAAGGAGACTATCATCGTTACTTG GCTGAGTTTAAGACGGGTGCGGAACGGAAGGAAGCTGCAGAATCTACTCTTACTGCTTACAAGGCTGCCCAG GACATTGCTACTACAGAGTTAGCCCCAACTCACCCCATTCGACTGGGATTGGCTTTAAACTTTTCTGTCTTTTAT TATGAAATCCTTAACAGCCCTGATCGCGCCTGCAACCTTGCGAAACAAGCCTTCGATGAGGCAATAGCTGAAT TGGATACATTAGGCGAAGAGAGTTACAAAGATTCAACTCTGATCATGCAGCTTTTACGTGATAATCTGACTTTA TGGACAAGCGATATGCAAGGTGGTAGTGGTGGATCTGGAGGGTCCGGCGGTTCCGGTGGTAGTGGTGGCTC TGGGGGTAGCGGCGGTAGCGGTGGGTCTGGCGGTAGTATGGCGGTTGCACCTACGGCACGTGAAGAGAATG TGTATATGGCAAAGCTCGCACGGCAGGCTGAAAGGTATGAAGAGATGGTTGAGTTCATGGAGAAGGTTTCCA ATTCCCTTGGCAGCGAAGAGCTTACCGTCGAGGAGCGCAACCTGCTCAGTGTCGCATACAAAAACGTCATCGG TGCGAGAAGGGCCTCGTGGCGGATTATTTCAAGCATTGAACAAAAAGAAGAGAGTAGAGGCAACGAAGAAC ACGTTAACAGCATCCGGGAGTACCGCAGTAAGATCGAGAACGAACTTTCTAAAATCTGCGATGGGATTTTAAA ACTGCTCGACGCAAAACTTATACCTAGCGCCGCATCAGGCGATAGTAAGGTTTTCTATCTGAAGATGAAGGGA GATTATCACCGATATCTGGCTGAATTCAAGACCGGGGCTGAGCGCAAAGAGGCGGCTGAGAGTACGCTCACG GCCTATAAAGCCGCTCAAGATATCGCAACGACTGAACTTGCACCAACGCATCCTATCCGGCTTGGCCTGGCGC TTAATTTCAGCGTGTTCTACTACGAGATATTGAATTCTCCAGACCGTGCTTGTAATCTGGCTAAGCAGGCGTTT GACGAAGCTATTGCCGAGCTGGACACGCTGGGGGAGGAATCTTATAAGGACAGCACCTTGATTATGCAACTG CTTCGAGACAACCTCACCCTCTGGACCTCTGACATGCAGGGTACCACTAGTGGCGGGAGTGGCGGTAGCGGA GGTTCTGGCGGCAGTGATGACGTGACCCCTTGTAGCATGTCTGGTGGCTCAGGTGGAAGCGAAAACCTGTAT TTCCAGTCCGGTGGCTCTGGTGGAAGCGGCGGATCCGGAGGGAGCGGTGGTTCCGGTGGCTCGGGCGGATC CGGGGGCAGCGGAGGTAGTGGTGGCTCAGGTGGTCTCCTGGCTGTGGCTCCTACTGCGCGCGAGGAAAACG TTTACATGGCGAAGCTGGCAGAACAAGCAGAGCGCTACGAGGAAATGGTGGAATTTATGGAAAAAGTGAGC AACAGTCTTGGTTCAGAGGAACTTACGGTGGAAGAACGTAATCTCCTGTCCGTTGCCTATAAGAATGTGATTG GAGCACGTCGTGCAAGCTGGCGTATAATCAGTCTCATCGAGCAGAAGGAGGAATCCCGTGGGAATGAGGAG CATGTAAATTCTATTCGCGAATACCGTTCTAAAATTGAAAATGAACTCAGTAAGATTTGTGACGGCATCCTGAA GTTGCTTGATGCCAAGCTGATCCCATCTGCTGCAAGCGGTGACTCTAAAGTGTTCTACTTAAAGATGAAAGGA GACTATCATCGTTACTTGGCTGAGTTTAAGACGGGTGCGGAACGGAAGGAAGCTGCAGAATCTACTCTTACTG CTTACAAGGCTGCCCAGGACATTGCTACTACAGAGTTAGCCCCAACTCACCCCATTCGACTGGGATTGGCTTTA AACTTTTCTGTCTTTTATTATGAAATCCTTAACAGCCCTGATCGCGCCTGCAACCTTGCGAAACAAGCCTTCGAT GAGGCAATAGCTGAATTGGATACATTAGGCGAAGAGAGTTACAAAGATTCAACTCTGATCATGCAGCTTTTAC GTGATAATCTGACTTTATGGACAAGCGATATGCAAGGTGGTAGTGGTGGATCTGGAGGGTCCGGCGGTTCCG GTGGTAGTGGTGGCTCTGGGGGTAGCGGCGGTAGCGGTGGGTCTGGCGGTAGTATGGCGGTTGCACCTACG GCACGTGAAGAGAATGTGTATATGGCAAAGCTCGCAGAGCAGGCTGAAAGGTATGAAGAGATGGTTGAGTT CATGGAGAAGGTTTCCAATTCCCTTGGCAGCGAAGAGCTTACCGTCGAGGAGCGCAACCTGCTCAGTGTCGC ATACAAAAACGTCATCGGTGCGAGAAGGGCCTCGTGGCGGATTATTTCAAGCATTGAACAAAAAGAAGAGAG TAGAGGCAACGAAGAACACGTTAACAGCATCCGGGAGTACCGCAGTAAGATCGAGAACGAACTTTCTAAAAT CTGCGATGGGATTTTAAAACTGCTCGACGCAAAACTTATACCTAGCGCCGCATCAGGCGATAGTAAGGTTTTC TATCTGAAGATGAAGGGAGATTATCACCGATATCTGGCTGAATTCAAGACCGGGGCTGAGCGCAAAGAGGCG GCTGAGAGTACGCTCACGGCCTATAAAGCCGCTCAAGATATCGCAACGACTGAACTTGCACCAACGCATCCTA TCCGGCTTGGCCTGGCGCTTAATTTCAGCGTGTTCTACTACGAGATATTGAATTCTCCAGACCGTGCTTGTAAT CTGGCTAAGCAGGCGTTTGACGAAGCTATTGCCGAGCTGGACACGCTGGGGGAGGAATCTTATAAGGACAGC ACCTTGATTATGCAACTGCTTCGAGACAACCTCACCCTCCGTACCTCTGACATGCAGGGTACCACTAGTGGCGG GAGTGGCGGTAGCGGAGGTTCTGGCGGCAGTGATGACGTGACCCCTTGTAGCATGTCTGGTGGCTCAGGTG GAAGCGAAAACCTGTATTTCCAGTCCGGTGGCTCTGGTGGAAGCGGCGGATCCGGAGGGAGCGGTGGTTCC GGTGGCTCGGGCGGATCCGGGGGCAGCGGAGGTAGTGGTGGCTCAGGTGGATCCCAAGGACTCTTAGATGC ATTAGACCTGGCCAGCGGAAGCACCTCGGGTACCACATCTGCGTGGAGCCATCCTCAGTTCGAAAAATAA

and show a clear bar around 9000 bases, which is the close to length of both tetramer constructs (8929).

Figure1: a schematic representation of a heterotetramer (top) and a homotetramer (bottom).
Figure 2: Depicted is an agarose gel, with in pocket 1 the heterotetramer and in pocket two the homotetramer. Both constructs have a length of 8929 bases.
caspase-9 assay

One of the applications we had in mind was creating a kill switch. For this caspase-9 proteins were used. An assay was designed in which activation of caspase-9 could be measured, see the experiments section. We planned to compare the level of activity from a dimer to the level of activity from a tetramer, because we expected that usage of a tetramer would result in a higher level of caspase-9 activation, since it resembles the natural occurring apoptosome more closely, since this is a septamer.

Even though the homotetramer was not expressed, we still performed the caspase-9 assay with the homodimer. In order to show that usage of a scaffold increases the measure of caspase-9 activation.

Figure 3: T14-3-3 homodimer caspase-9 assay. The concentration of scaffold is varied from 0 nM to 1 µM. The concentration of CT52-caspase-9 used is 200 nM and the concentration of fusicoccin used is 50 µM. On the x-axis the slope of the measured fluorescence is presented.

The first bar (figure 3) shows the measure of caspase-9 activity when there is no scaffold present, this can be seen as the ‘background’. In the next bars the concentration varies from 100 nM to 1 µM. Interestingly the measure of caspase activity when scaffold is present is significantly higher than the background. It would have definitely been interesting to test the tetramer, since the tetramer represents the natural apoptosome more.

×

Loading ...