Team:Toronto/Notebook-w03-mon
console.js:26
Week 3: May 30, 2016
Monday, 5/30
Members present: Cathy, Celine, Alex, Bohdan, Hamed, Andrea, Davesh, Kat, Tam
Lab Stuff: (research, plasmid design, protocol design, troubleshooting)
●
Looked into nickel-specific transcriptional regulators
○
Two candidates were identified: NimR and rcnR (Co2+ and Ni2+)
■
rcnR is a transcriptional repressor which allows for transcription in the presence of Ni2+
○
rcnR variants (esp C35A) have been shown to be insensitive to Co2+
●
Arsenic (non-MerR):
○
AsrR represses asr via binding, and this binding is inhibited by the presence of Arsenite (see References)
●
Table of metal regulators (MerR family):
A | B | C | |
1 | Name | Description | Promoter Info |
2 | Zinc | ||
3 | ZntR | -also reacts to Cd and Hg -regulator of ZntA ATPase | http://onlinelibrary.wiley.com/doi/10.1046/j.1365-2958.1999.01229.x/epdf Figure 4 |
4 | PmtR | -zinc specific | http://www.jbc.org/content/273/33/21393.long Figure 2 |
5 | Copper | ||
6 | CueR /Ybbl | -also reacts to silver -regulator of copA transporter | http://onlinelibrary.wiley.com/doi/10.1046/j.1365-2958.2001.02264.x/full Figure 3 |
7 | SctR | -no experimentation done with regards to other metals -regulator of CuiD oxidase | http://femsle.oxfordjournals.org/content/210/1/99.long Figure 2 |
8 | Others | ||
9 | PbrR | -lead resistance | http://femsre.oxfordjournals.org/content/27/2-3/145 Figure 6 |
10 | CadR | -cadmium resistance -represses itself, but not cadA | " |
11 | MerR | -mercury resistance | " |
Table2
GolS Purification protocol:
●
In the article “DNA Distortion Mechanism for Transcriptional Activation by ZntR, a Zn(II)-responsive MerR Homologue in Escherichia coli”:
●
The article indicates purification protocol suggested and been used for several MerR family in general. It has been suggested to be used for ZntR (Zn(II) homologue in E.coli), CueR (Cu(II) homologue in E.coli) which belong to the MerR family and GolS itself (underneath)
Protocols listed for ZntR:
"ZntR gene was cloned from the E. coli chromosome using the primers ZntR N-terminal (59-CTA GTG GAG TAC ATA TGT ATC GCA TTG G-39) and ZntR C-terminal (59-GTA ATC CTG CGG ATC CAA AAA ATC AAC AAC C-39). The 461-bp PCR fragment was digested with NdeI and BamHI and inserted into pET11c (Novagen) digested with the same enzymes. The resulting overexpression plasmid (pET11cZntR) was transformed into BL21(DE3) cells (Novagen). The cells were grown in 9 liters of Luria Bertani broth with shaking at 37 °C and induced with 400 mM IPTG at A600 5 0.6. The cells were harvested by centrifugation 2.5 h after IPTG induction and then stored at -80 °C. The pelleted cells were frozen and thawed three times (45) and then resuspended in 250 ml of Tris buffer A (50 mM Tris-Cl, pH 8.0, 2 mM EDTA, and 5 mM DTT). The cell debris was removed by centrifugation, and the protein in the supernatant was precipitated with 45% (NH4)2SO4. The precipitated protein was then resuspended in 10 ml of Tris buffer A and desalted on a Sephadex G-25 column. The crude protein extract was subsequently loaded onto a Heparin column equilibrated with Tris buffer B (20 mM Tris, pH 8.0, 5 mM DTT). Following elution with a NaCl gradient, the protein fractions were collected and (NH4)2SO4 was added to a final concentration of 1.2 M. The protein was then loaded onto a Phenyl-Sepharose High Performance hydrophobic column (Amersham Pharmacia Biotech) in Tris buffer C (50 mM Tris, pH 8.0, 1.2 M (NH4)2SO4,5mM DTT). The protein was eluted with a decreasing salt gradient, coming off at 0.5–0.3 M (NH4)2SO4, and the protein-containing fractions were concentrated to 2 ml. As a final purification step, the protein was loaded onto a High Load Superdex 75 gel filtration column (Amersham Pharmacia Biotech) equilibrated with Tris buffer D (50 mM Tris, pH 8.0, 250 mM NaCl, 5 mM DTT). The ZntR fractions were concentrated to ;1–2 ml and showed a single band on overloaded SDS-PAGE gels. Protein was stored at 280 °C in Tris buffer D with 5% glycerol. The molecular mass of ZntR (calculated: 16179.3 Da with first Met) was found by matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) (PerSpective Biosystems Voyager-DE) to be 16178.1 Da using a sinapinic acid matrix with myoglobin as the calibration standard. "
Potential alternative of Superdex 75: Sephacryl S-100 HR.
●
It induces a slightly broader fractionation range (compared to Superdex) and retains high chemical stability and tolerance of high flow rates, for a significantly lower price. (SKU S100HR-100ML, $214.00/100mL of Sephacryl).
●
Note that reverse flowshould not be used for Sephacryl columns.
Prices of the highlighted items:
●
HiTrap Heparin HP: heparin sepharose (higher cross-linked) 5 of 1mL is $243.04
○
Supplier: GE Healthcare Life Sciences
○
Product code: 17-0406-01
●
Phenyl Sepharose High Performance of 75ml is $513.36
○
Supplier: GE Healthcare Life Sciences
○
Product code: 17-1082-01
●
HiLoad Superdex 75 PG is $3098.76
○
Supplier: GE Healthcare Life Sciences
○
Product code: 28989333
●
Sephacryl S-100 HR of 100mL is $214.00
○
Supplier:Sigma Aldrich
○
Product code: S100HR-100ML
●
Sephadex G-25 Medium of 100g is $303.80
○
Supplier: GE Healthcare Life Sciences
○
Product code: 17-0033-01
●
Heparin−Agarose Type I, saline suspension is $107.00
○
Supplier: Sigma Aldrich
○
Sigma Product code: H6508-5ML
Supplementary Notes for Protocols:
●
Some of the highlighted parts are significant steps to the procedure and suggested to be costly in the budget. However, based on one article upon CueR purification, they suggested skipping the hydrophobic column step. There are some missing key components on what resin should be used for the heparin column, sephadex
●
Further contact with Naveen, Kayla, Dr. Thomas O'Halloran and potentially others.
●
pI of GolS is 9.66 (calculated based on sequence using ExPASy).
GolS 3D Structure:
We have reassessed an actual 3D structure analysis of GolS, GolS A113T, GolS A113T and P118, CupR.
GolS - Job ID S276431 from I-TASSER:
The GolS predicted C-terminus secondary structure does not conform helix nor beta structure. C-terminus behaves like a freely coiled tail. The tail presents certain concerns upon insertion of the His-tag like for ex, inhibition of dimerization or hindrance to the DNA binding property.
Suggestion for the upcoming 3D models:
●
Visualization of wt GolS with both noncleavable and cleavable His-tags (Ser and Gly ends):
GolS noncleavable His-tag: Tam
GolS cleavable His-tag Gly: Cathy
GolS cleavable His-tag Ser: Alex
●
Another recommendation upon modeling GolS and its variants:
We will be exploring programs that monitor ligand binding sites particularly different heavy metal ions (Au(III), Au(I), Cu(I), Ag(I), etc...) in order to compare the specificity based on distances of the binding pocket chelation and structural changes between them.
Program suggested at the moment: COACH from University of Michigan
Paper design protocol:
●
Worked on a protocol from Pardee, K. 2014. Will be posted on benchling when complete
RBS Design:
A | B | C | D | |
1 | Pre-sequence | Sequence | Hamed | Kat |
2 | pGolB | GolS | AGAAACACACGCATAAGGAGGTACACC | |
3 | pGolB | golS (A113T and P118A) | GGCCAGCCATATTAAGGAGGTATCAC | |
4 | pGolB | golS (A113T) | AATACGGAAAGATAGGTATAAGGAGGTCGCAA | |
5 | pGolB | golS (P118A) - almost insensitive to Cu(I) | GAATAAGGAGGTAATAT | |
6 | pGolB | golS with CupR(C. metallidurans)-like metal-binding site | GCCGCGGAAGGCCTAATACAGTAAGGAGGTAAGTT | |
Table1
Administrative: (shipment orders, inventory)
●
Follow-up text sent to Umar regarding RBS question
Email Updates: (Correspondance with proffessors, shipping companies, etc)
Meeting Notes:
References:
- subsection on metal-dependent regulators (nothing on nickel)
-may bind to other metals
-may not be viable, little other information on NimR
-inducing a C35A point mutation in rncR eliminates Co2+ binding, making it Ni2+ specific
-see figures 2 and 3
-ZntR is a sensitive zinc-specific transcriptional activator
-also binds in small amounts to Cd and Hg
-they made a MerR/ZntR hybrid protein that recognizes Zn with reduced Hg response (see figure 4)
- Compares different exclusion collumns, their resolutions, flow-rate, and ellution efficiency
-Arsenic-sensing/resistance system
-may be overly-complicated
Tasks for tomorrow:
●
RBS Calculator
●
Luciferase
●
i-Tasser with cleavable and non-cleavable His Tags
●
COACH for ligands
●
The CRISPR grant
●
Purification protocol
