Team:UGent Belgium/Primers

Bootstrap 101 Template



Used primers


Primer Sequence
oM7624_Fw_Verification_pSB1C3 CCACCTGACGTCTAAGAAAC
oM7625_Rv_Verification_pSB1C3 GTATTACCGCCTTTGAGTGA
oM7626_inaX?_fw ATGATCGTTGAAAAGATTTTGGCATTGCGTAC
oM7627_inaX?_rv TCAGACATCGCGCAGTTCCTCGCCAGTGCC
oM7628_BsaI-inaZ_fw ACGTGGTCTCTGATGAATCTCGACAAGGCGTTG
oM7629_BsaI-inaZ_rv* ACGTGGTCTCTAGTACTACTTTACCTCTATCCAGTC
oM7643_Rv_BB_strong AGGACTGAGCTAGCTGTCAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCG
oM7644_Rv_BB_weak AGGACTGAGCTAGCCGTAAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCG
oM7645_Fw_BB TGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAG
oM7658_inaZ_GGfix_2_Fw AGTAGGTCTCAGTAACGAAACCGCTGGCAACCACAGTGATC
oM7659_inaZ_GGfix_3_Fw TAACGGTCTCAGGCGGGTGACCAAAGCAGATTGACCGCTG
oM7661_GFP_Fw-ATCT AGTCGGTCTCAATCTAGTAAAGGAGAAGAACTTTTCACTGGAG
oM7662_GFP_Fw-GATG AGTCGGTCTCAGATGAGTAAAGGAGAAGAACTTTTCACTGGAG
oM7663_GFP_Rv-ATCT AGCTGGTCTCAAGATCCGGTGCTGCCTTTGTAGAGCTCATCCATGCCATG
oM7664_GFP_Rv-TACT AGCTGGTCTCAAGTATTATTTGTAGAGCTCATCCATGCCATG
oM7665_INP_RC_Fw AGTCGGTCTCAGATGCCGCAGAATGTGCAGAC
oM7666_INP_RC_Rv AGCTGGTCTCAAGATCCGGTGCTGCCCTTTACCTCTATCCAGTCATCGTCCTCGTC
oM7667_Lpp_Fw AGTCGGTCTCAGATGAAAGCTACTAAACTGGTACTGG
oM7668_Strep_Rv AGTCGGTCTCAAGTATTATTAATGGTGGTGATGGTGATGGGA
oM7669_FW_BB_LC TGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGGAGTCACTAAGGGTTAG
oM7670_RV_BB_weak_LC AGGACTGAGCTAGCCGTAAACTCTAGAAGCGGCCGCGAATTCGAGTCACTAAGGGCTAAC
oM7671_RV_insert AGTATATAAACGCAGAAAGGCC
oM7672_FW_Insert_weak TTTACGGCTAGCTCAGTCCTAG
oM7673_inaZ_GGfix_1_Rv CAATTAGATCACTGTGGTTGCCAG
oM7674_inaZ_GGfix_2_Rv TCTTACCAGCGGTCAATCTGCTTTGGTC
oM7675_FW_BB_pSB3K3 TGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAACGGGCAAG
oM7676_BB_mSA2_Fw GCTGCAGTCCGGCAAAAAAGGGCAAG
oM7677_BB_mSA2_Rv CCGCGAATTCCAGAAATCATCCTTAGCG
oM7714_bb-pSC101_fw CCTAGGACTGAGCTAGCTGTCAATAGGGCAGCAGATAGGGACGAC
oM7715_bb-pSC101_rv GTGGGCCTTTCTGCGTTTATATACTCTTTTATTGGAGAGGTGGACAAG
oM7722_BB_GFP_Fw ACGTGGTCTCATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTG
oM7723_BB_GFP_Rv AGTCGGTCTCACATCTAGAAGCGGCCGCGAATTCCAGAAATCATCC

×

Loading ...