Line 1: | Line 1: | ||
{{Virginia/Team}} | {{Virginia/Team}} | ||
+ | |||
+ | |||
+ | <!-- start new wiki code! --> | ||
<html> | <html> | ||
+ | <!DOCTYPE html> | ||
+ | <html lang="en" dir="ltr" class="client-nojs"> | ||
+ | <head> | ||
+ | <meta charset="UTF-8" /> | ||
+ | <title>Team:Marburg/Members - 2015.igem.org</title> | ||
+ | <meta name="generator" content="MediaWiki 1.24.1" /> | ||
+ | <link rel="shortcut icon" href="/favicon.ico" /> | ||
+ | <link rel="search" type="application/opensearchdescription+xml" href="/wiki/opensearch_desc.php" title="2015.igem.org (en)" /> | ||
+ | <link rel="EditURI" type="application/rsd+xml" href="https://2015.igem.org/wiki/api.php?action=rsd" /> | ||
+ | <link rel="alternate" hreflang="x-default" href="/Team:Marburg/Members" /> | ||
+ | <link rel="copyright" href="http://creativecommons.org/licenses/by/3.0/" /> | ||
+ | <link rel="alternate" type="application/atom+xml" title="2015.igem.org Atom feed" href="/wiki/index.php?title=Special:RecentChanges&feed=atom" /> | ||
+ | <link rel="stylesheet" href="https://2015.igem.org/wiki/load.php?debug=false&lang=en&modules=mediawiki.legacy.commonPrint%2Cshared%7Cmediawiki.skinning.content.externallinks%7Cmediawiki.skinning.interface%7Cmediawiki.ui.button%7Cskins.igem.styles&only=styles&skin=igem&*" /> | ||
+ | <!--[if IE 6]><link rel="stylesheet" href="/wiki/skins/Igem/IE60Fixes.css?303" media="screen" /><![endif]--> | ||
+ | <!--[if IE 7]><link rel="stylesheet" href="/wiki/skins/Igem/IE70Fixes.css?303" media="screen" /><![endif]--><meta name="ResourceLoaderDynamicStyles" content="" /> | ||
+ | <style>a:lang(ar),a:lang(kk-arab),a:lang(mzn),a:lang(ps),a:lang(ur){text-decoration:none} | ||
+ | /* cache key: 2015_igem_org:resourceloader:filter:minify-css:7:875d2068ffef0b9ce1dbab8400ce2379 */</style> | ||
+ | <script src="https://2015.igem.org/wiki/load.php?debug=false&lang=en&modules=startup&only=scripts&skin=igem&*"></script> | ||
+ | <script>if(window.mw){ | ||
+ | mw.config.set({"wgCanonicalNamespace":"","wgCanonicalSpecialPageName":false,"wgNamespaceNumber":0,"wgPageName":"Team:Marburg/Members","wgTitle":"Team:Marburg/Members","wgCurRevisionId":413202,"wgRevisionId":413202,"wgArticleId":22958,"wgIsArticle":true,"wgIsRedirect":false,"wgAction":"view","wgUserName":"Andersnelson1","wgUserGroups":["*","user","autoconfirmed"],"wgCategories":[],"wgBreakFrames":false,"wgPageContentLanguage":"en","wgPageContentModel":"wikitext","wgSeparatorTransformTable":["",""],"wgDigitTransformTable":["",""],"wgDefaultDateFormat":"dmy","wgMonthNames":["","January","February","March","April","May","June","July","August","September","October","November","December"],"wgMonthNamesShort":["","Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec"],"wgRelevantPageName":"Team:Marburg/Members","wgUserId":5372,"wgUserEditCount":0,"wgUserRegistration":1465834027000,"wgUserNewMsgRevisionId":null,"wgIsProbablyEditable":false,"wgRestrictionEdit":[],"wgRestrictionMove":[],"wgWikiEditorEnabledModules":{"toolbar":false,"dialogs":false,"hidesig":true,"preview":false,"previewDialog":false,"publish":false}}); | ||
+ | }</script><script>if(window.mw){ | ||
+ | mw.loader.implement("user.options",function($,jQuery){mw.user.options.set({"ccmeonemails":0,"cols":80,"date":"default","diffonly":0,"disablemail":0,"editfont":"default","editondblclick":0,"editsectiononrightclick":0,"enotifminoredits":0,"enotifrevealaddr":0,"enotifusertalkpages":1,"enotifwatchlistpages":1,"extendwatchlist":0,"fancysig":0,"forceeditsummary":0,"gender":"unknown","hideminor":0,"hidepatrolled":0,"imagesize":2,"math":1,"minordefault":0,"newpageshidepatrolled":0,"nickname":"","norollbackdiff":0,"numberheadings":0,"previewonfirst":0,"previewontop":1,"rcdays":7,"rclimit":50,"rows":25,"showhiddencats":0,"shownumberswatching":1,"showtoolbar":1,"skin":"igem","stubthreshold":0,"thumbsize":5,"underline":2,"uselivepreview":0,"usenewrc":1,"watchcreations":1,"watchdefault":1,"watchdeletion":0,"watchlistdays":3,"watchlisthideanons":0,"watchlisthidebots":0,"watchlisthideliu":0,"watchlisthideminor":0,"watchlisthideown":0,"watchlisthidepatrolled":0,"watchmoves":0,"watchrollback":0, | ||
+ | "wllimit":250,"useeditwarning":1,"prefershttps":1,"language":"en","variant-gan":"gan","variant-iu":"iu","variant-kk":"kk","variant-ku":"ku","variant-shi":"shi","variant-sr":"sr","variant-tg":"tg","variant-uz":"uz","variant-zh":"zh","searchNs0":true,"searchNs1":false,"searchNs2":false,"searchNs3":false,"searchNs4":false,"searchNs5":false,"searchNs6":false,"searchNs7":false,"searchNs8":false,"searchNs9":false,"searchNs10":false,"searchNs11":false,"searchNs12":false,"searchNs13":false,"searchNs14":false,"searchNs15":false});},{},{});mw.loader.implement("user.tokens",function($,jQuery){mw.user.tokens.set({"editToken":"c4f552d13137b49a8fc57eceba7d3db1+\\","patrolToken":"31205305b94eaeb3a8edf1395284062a+\\","watchToken":"b40c9933c63eb0f45f3b32839b6a03ba+\\"});},{},{}); | ||
+ | /* cache key: 2015_igem_org:resourceloader:filter:minify-js:7:2014ecdbecc709fa97196f64aaf48cee */ | ||
+ | }</script> | ||
+ | <script>if(window.mw){ | ||
+ | mw.loader.load(["mediawiki.page.startup","mediawiki.legacy.wikibits","mediawiki.legacy.ajax"]); | ||
+ | }</script> | ||
+ | </head> | ||
+ | <body class="mediawiki ltr sitedir-ltr ns-0 ns-subject page-Team_Marburg_Members skin-igem action-view"> | ||
+ | |||
+ | <script type='text/javascript' src ='/common/tablesorter/jquery.tablesorter.min.js'></script> | ||
+ | <link rel='stylesheet' type='text/css' href='/common/tablesorter/themes/groupparts/style.css' /> | ||
+ | <link rel='stylesheet' type='text/css' href='/common/table_styles.css' /> | ||
+ | |||
+ | <div id='globalWrapper'> | ||
+ | <div id='top_menu_under' class='noprint'></div> | ||
+ | <div id='top_menu_14' class='noprint'>Loading menubar.....</div> <!-- Will be replaced with the jQuery.load --> | ||
+ | <script>jQuery('#top_menu_14').load('https://2015.igem.org/cgi/top_menu_14/menubar_reply.cgi', | ||
+ | { t:"Team%3AMarburg%2FMembers", | ||
+ | a:"View+%2FTeam%3AMarburg%2FMembers++View source+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AMarburg%2FMembers%26action%3Dedit++History+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AMarburg%2FMembers%26action%3Dhistory++Move+%2FSpecial%3AMovePage%2FTeam%3AMarburg%2FMembers++Watch+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AMarburg%2FMembers%26action%3Dwatch%26token%3D1911fd0312785c762a54358887f8f5e2%252B%255C++Page+%2FTeam%3AMarburg%2FMembers++Discussion+%2Fwiki%2Findex.php%3Ftitle%3DTalk%3ATeam%3AMarburg%2FMembers%26action%3Dedit%26redlink%3D1++" }); | ||
+ | |||
+ | </script> | ||
+ | <div id="content" class="mw-body" role="main"> | ||
+ | <a id="top"></a> | ||
+ | <h1 id="firstHeading" class="firstHeading"> | ||
+ | <span dir="auto">Team:Marburg/Members</span> | ||
+ | </h1> | ||
+ | <div id="bodyContent"> | ||
+ | <div id="mw-content-text" lang="en" dir="ltr" class="mw-content-ltr"><p> | ||
+ | |||
+ | <script type="text/javascript" src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script> | ||
+ | |||
+ | <style type="text/css"> | ||
+ | |||
+ | /* width */ | ||
+ | |||
+ | #contentSub, #search-controls, .firstHeading, #footer-box, #p-logo { | ||
+ | display:none;} | ||
+ | |||
+ | #top-section { | ||
+ | border: none; | ||
+ | height: 0px | ||
+ | } | ||
+ | |||
+ | #globalWrapper, #content { | ||
+ | width: 100%; | ||
+ | height: 100%; | ||
+ | border:none; | ||
+ | background-color: #fff; | ||
+ | margin-top: 0px; | ||
+ | margin-right: 0px; | ||
+ | padding: 0px; | ||
+ | } | ||
+ | |||
+ | html, #bodyContent, body, #container { | ||
+ | background-color: #fff; | ||
+ | width:100%; | ||
+ | height:100%; | ||
+ | box-sizing: border-box; | ||
+ | } | ||
+ | |||
+ | /* General Style */ | ||
+ | |||
+ | html, body, img, sub, sup, var, center, label, caption, header, menu, nav{ | ||
+ | margin: 0; | ||
+ | padding: 0; | ||
+ | border: 0; | ||
+ | vertical-align: baseline; | ||
+ | |||
+ | } | ||
+ | |||
+ | |||
+ | h3, h4, h5, h6, { | ||
+ | margin: 0; | ||
+ | padding: 0; | ||
+ | border: 0; | ||
+ | vertical-align: baseline; | ||
+ | } | ||
+ | |||
+ | article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section { | ||
+ | display: block; | ||
+ | } | ||
+ | |||
+ | body { | ||
+ | background-image:url('https://static.igem.org/mediawiki/2015/5/5c/MR_pic_bg_1.jpg'); | ||
+ | } | ||
+ | |||
+ | /* Navigation */ | ||
+ | |||
+ | #nav { | ||
+ | margin:0; | ||
+ | padding:0; | ||
+ | } | ||
+ | |||
+ | ul#navigation { | ||
+ | margin:0 auto; | ||
+ | float:left; | ||
+ | height:100%; | ||
+ | width:100%; | ||
+ | } | ||
+ | |||
+ | ul#navigation li { | ||
+ | display:inline; | ||
+ | font-size:11px; | ||
+ | font-family: 'Open Sans', sans-serif; | ||
+ | margin:0; | ||
+ | padding:0; | ||
+ | float:left; | ||
+ | position:relative; | ||
+ | height:100%; | ||
+ | } | ||
+ | |||
+ | ul#navigation li a { | ||
+ | padding:10px 5px; | ||
+ | color:#616161; | ||
+ | text-shadow:1px 1px 0px #fff; | ||
+ | text-decoration:none; | ||
+ | display:inline-block; | ||
+ | |||
+ | -webkit-transition:color 0.2s linear, background 0.2s linear; | ||
+ | -moz-transition:color 0.2s linear, background 0.2s linear; | ||
+ | -o-transition:color 0.2s linear, background 0.2s linear; | ||
+ | transition:color 0.2s linear, background 0.2s linear; | ||
+ | } | ||
+ | |||
+ | ul#navigation li a:hover { | ||
+ | background:#f8f8f8; | ||
+ | color:#282828; | ||
+ | } | ||
+ | |||
+ | ul#navigation li:hover > a { | ||
+ | background:#fff; | ||
+ | } | ||
+ | |||
+ | /* Drop-Down Navigation */ | ||
+ | |||
+ | ul#navigation li:hover > ul | ||
+ | { | ||
+ | visibility:visible; | ||
+ | opacity:1; | ||
+ | } | ||
+ | |||
+ | ul#navigation ul, ul#navigation ul li ul { | ||
+ | list-style: none; | ||
+ | margin: 0; | ||
+ | padding: 0; | ||
+ | visibility:hidden; | ||
+ | position: absolute; | ||
+ | z-index: 99999; | ||
+ | width:180px; | ||
+ | background:#f8f8f8; | ||
+ | box-shadow:1px 1px 3px #ccc; | ||
+ | opacity:0; | ||
+ | |||
+ | -webkit-transition:opacity 0.2s linear, visibility 0.2s linear; | ||
+ | -moz-transition:opacity 0.2s linear, visibility 0.2s linear; | ||
+ | -o-transition:opacity 0.2s linear, visibility 0.2s linear; | ||
+ | transition:opacity 0.2s linear, visibility 0.2s linear; | ||
+ | } | ||
+ | |||
+ | ul#navigation ul { | ||
+ | top: 91px; | ||
+ | left: 1px; | ||
+ | } | ||
+ | |||
+ | ul#navigation ul li ul { | ||
+ | top: 0; | ||
+ | left: 181px; | ||
+ | } | ||
+ | |||
+ | ul#navigation ul li { | ||
+ | clear:both; | ||
+ | width:100%; | ||
+ | border:0 none; | ||
+ | border-bottom:1px solid #c9c9c9; | ||
+ | } | ||
+ | |||
+ | ul#navigation ul li a { | ||
+ | background:none; | ||
+ | padding:7px 15px; | ||
+ | color:#616161; | ||
+ | text-shadow:1px 1px 0px #fff; | ||
+ | text-decoration:none; | ||
+ | display:inline-block; | ||
+ | border:0 none; | ||
+ | float:left; | ||
+ | clear:both; | ||
+ | width:150px; | ||
+ | } | ||
+ | |||
+ | ul#navigation li a.first { | ||
+ | border-left: 0 none; | ||
+ | } | ||
+ | |||
+ | ul#navigation li a.last { | ||
+ | border-right: 0 none; | ||
+ | } | ||
+ | |||
+ | .first{ | ||
+ | width:110px; | ||
+ | text-align:center; | ||
+ | } | ||
+ | |||
+ | /* Social Media Menu */ | ||
+ | |||
+ | ul#socialmedia li { | ||
+ | padding:5px; | ||
+ | height:100%; | ||
+ | float:left; | ||
+ | } | ||
+ | |||
+ | .second{ | ||
+ | width:30px; | ||
+ | text-align:center; | ||
+ | } | ||
+ | |||
+ | |||
+ | #smbuttons img {margin:0 2px;} | ||
+ | |||
+ | #maillink {padding-right: 2px;} | ||
+ | |||
+ | /* Select-Style */ | ||
+ | |||
+ | ::selection { | ||
+ | background: #FF8F45; /* WebKit/Blink Browsers */ | ||
+ | } | ||
+ | |||
+ | ::-moz-selection { | ||
+ | background: #FF8F45; /* Gecko Browsers */ | ||
+ | } | ||
+ | |||
+ | a { | ||
+ | text-decoration:none; | ||
+ | color: #FF6600; | ||
+ | } | ||
+ | a:visited { | ||
+ | color: #FF6600; | ||
+ | } | ||
+ | a:hover { | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | |||
+ | </style> | ||
+ | |||
+ | |||
+ | <!--JS for Mailus--> | ||
+ | <script> | ||
+ | $(document).ready(function() { | ||
+ | $('#maillink').hover(function() { | ||
+ | console.log("AAA"); | ||
+ | var link = 'mailto:igemteam!#%synmikro.uni-marburg.de'; | ||
+ | $(this).attr('href',link.replace("!#%","@")); | ||
+ | }); | ||
+ | }); | ||
+ | </script> | ||
+ | |||
+ | |||
+ | <!--HTML-MENU--> | ||
+ | |||
+ | <body style="height:100%;min-width:100%;margin:0px; padding:0px;"> | ||
+ | <div style="position:fixed;width:100%; min-width:100%; height:100%;min-height:100%; background-image: url('https://static.igem.org/mediawiki/2015/6/6f/MR_pic_bg6.jpg');background-repeat: no-repeat; | ||
+ | background-attachment: fixed;-webkit-background-size: cover; | ||
+ | -moz-background-size: cover; | ||
+ | -o-background-size: cover; | ||
+ | background-size: cover; | ||
+ | margin:0px; padding:0px;"></div> | ||
+ | <div style="position:absolute;margin-left:-680px;left:50%;width:1360px;min-width:1360px;min-height:100%;background-color:white;padding-bottom:10px;"> | ||
+ | <div style="position:fixed;width:1360px;min-width:1360;height:70px;z-index:20;margin-top:0px;"> | ||
+ | <div style="display:table;min-width:1360px;height:100%;"> | ||
+ | <div style="display:table-row;"> | ||
+ | <div style="display:table-cell;width:188px;background:white;"> | ||
+ | <a href="https://2015.igem.org/Team:Marburg" style="text-align:center;"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/1/14/MR_pic_Home.png" style="position:relative;height:66px;padding-bottom:11px;padding-left:8px;padding-right:8px;"> | ||
+ | </a> | ||
+ | </div> | ||
+ | <div style="display:table-cell;background:#E0E0E0;padding-left:20px;"> | ||
+ | <nav id="nav"> | ||
+ | <ul id="navigation" style="margin-top:9px;"> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Projects" class="first"><img src="https://static.igem.org/mediawiki/2015/5/56/MR_pic_Projects.png" style="height:60px;text-align:center;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Description">Overview</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Background">Fact Sheets</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Minicells">NUTRInity - Provide</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Curli">NUTRInity - Pick up</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/CDI">NUTRInity - Cut off</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Design">Future Application</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/InterLab">InterLab Study</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Measurement">Measurement Study</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Practices" class="first"><img src="https://static.igem.org/mediawiki/2015/3/3a/MR_pic_HP.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/iGeneration">iGeneration</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Hessentag">Hessentag</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Killswitch">KillSwitch Statistics</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Achievements" class="first"><img src="https://static.igem.org/mediawiki/2015/b/ba/MR_pic_Achievements.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Parts">Parts</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Results">Results</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Medal Fulfillment">Medal Fulfillment</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Collaborations" class="first"><img src="https://static.igem.org/mediawiki/2015/7/71/MR_pic_Collaborations.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Meetup">MeetUp</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Gameofcells">Game of Cells</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Notebook" class="first"><img src="https://static.igem.org/mediawiki/2015/5/53/MR_pic_Notebook.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Labbook">Lab Book</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Protocols">Protocols</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Bibliography">Bibliography</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Team" class="first"><img src="https://static.igem.org/mediawiki/2015/1/1d/MR_pic_Team.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Members">Members</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Acknowledgement">Acknowledgement</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Attributions">Attributions</a></li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Gallery">Gallery</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Safety" class="first"><img src="https://static.igem.org/mediawiki/2015/6/6a/MR_pic_Safety.png" style="height:60px;"></a> | ||
+ | <ul> | ||
+ | <li><a href="https://2015.igem.org/Team:Marburg/Killswitch">KillSwitch Statistics</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
+ | </nav> | ||
+ | </div> | ||
+ | <div id="socialmedia" style="display:table-cell;background:#E0E0E0;text-align:right;padding-right:5px;vertical-align:middle;"> | ||
+ | <span id="smbuttons"> | ||
+ | <a href="https://www.facebook.com/igemmarburg" class="second" style="padding:5px;"><img src="https://static.igem.org/mediawiki/2015/7/71/MR_pic_Facebook.png" style="width:30px;"></a> | ||
+ | <a href="https://twitter.com/igem_marburg" class="second" style="padding:5px;"><img src="https://static.igem.org/mediawiki/2015/7/75/MR_pic_Twitter.png" style="width:30px;"></a> | ||
+ | <a id="maillink" href="#" style="padding:5px;" class="second"><img src="https://static.igem.org/mediawiki/2015/a/a0/MR_pic_Mailus.png" style="width:30px;" alt="submit"></a> | ||
+ | <a href="https://2015.igem.org/Main_Page" class="second" style="padding:5px;"><img src="https://static.igem.org/mediawiki/2015/9/9b/MR_pic_Igem.png" style="width:30px;"></a> | ||
+ | </span> | ||
+ | </div><!-- cell --> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div><!-- row --> | ||
+ | |||
+ | <div style="position:fixed;min-height:100%;height:100%;width:195px;background:#E0E0E0;top:115px;z-index:20;vertical-align:middle;"> | ||
+ | <span style="margin:0px; padding:0px;display:inline-block;height:100%;vertical-align:middle;"> | ||
+ | </span> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/1/1c/MR_pic_Sidebanner_Home.png" style="width:184px;vertical-align:middle;"> | ||
+ | </div> | ||
+ | <div style="position:fixed;margin-left:640px;height:100%;min-height:100%;min-width:40px; width:40px; top:115px;background:#E0E0E0; left:50%;z-index:2;"></div> | ||
+ | |||
+ | <div> | ||
+ | <div style="position:relative;text-align:center;z-index:1;background:white;font-size:13pt;line-height:150%;min-width:100%;max-width:100%;padding-top:132px; padding-left:235px; padding-right:80px;padding-bottom:70px;box-sizing: border-box;"> | ||
+ | |||
+ | <div style="z-index:1;text-align:center;padding-bottom:40px;"><img src="https://static.igem.org/mediawiki/2015/e/e5/MR_pic_Button_Members.png" style="height:60px;"/></div> | ||
+ | |||
+ | |||
+ | <style> | ||
+ | |||
+ | .Anchor { | ||
+ | background-color:#FF8F45; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-style:solid; | ||
+ | border-radius:7px; | ||
+ | padding:4px; | ||
+ | margin:8px; | ||
+ | width:174px; | ||
+ | margin-bottom:30px; | ||
+ | text-align:center; | ||
+ | } | ||
+ | |||
+ | .Anchor:hover { | ||
+ | opacity:0.6; | ||
+ | filter: alpha(opacity=60); | ||
+ | } | ||
+ | |||
+ | a { | ||
+ | text-decoration:none; | ||
+ | color: white; | ||
+ | } | ||
+ | a:visited { | ||
+ | color: white; | ||
+ | } | ||
+ | a:hover { | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | |||
+ | .anni{ | ||
+ | display: block; | ||
+ | height: 95px; /*same height as header*/ | ||
+ | margin-top: -95x; /*same height as header*/ | ||
+ | visibility: hidden; | ||
+ | } | ||
+ | </style> | ||
+ | |||
+ | <center> | ||
+ | <table> | ||
+ | <td> | ||
+ | <div class="Anchor"><a href="#Stu">Students</a></div> | ||
+ | </td> | ||
+ | <td> | ||
+ | <div class="Anchor"><a href="#Ad">Advisors</a></div> | ||
+ | </td> | ||
+ | </table> | ||
+ | </center> | ||
+ | |||
+ | <span id="Stu"></span> | ||
+ | <center><h1>Students</h1></center> | ||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | margin-top:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/9/9b/MR_pic_Team_Anna_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:left;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Anna Knörlein</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GCAAACAACGCA</li> | ||
+ | <li><b>Age:</b> 23</li> | ||
+ | <li><b>Field of Study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Phenylalanine</li> | ||
+ | <li><b>Protein:</b> Membrane Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Richard P. Feynman</li> | ||
+ | <li><b>Project:</b> ILS/Measurement</li> | ||
+ | <li><b>Known As:</b> Master of Organization</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/0/05/MR_pic_Team_Matthias_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:left;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Matthias Franz</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> ATGGCCACCACTCATATTGCTAGC</li> | ||
+ | <li><b>Age:</b> 23</li> | ||
+ | <li><b>Field of Study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Arginine</li> | ||
+ | <li><b>Protein:</b> Zinc Finger</li> | ||
+ | <li><b>Favorite Scientist:</b> Richard Dawkins</li> | ||
+ | <li><b>Project:</b> Provide</li> | ||
+ | <li><b>Known as:</b> The Grammar N... Nerd</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8 ; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/4/47/MR_pic_Team_Andy_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Andreas Herdlitschka</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GCAAACGACTAT</li> | ||
+ | <li><b>Age:</b> 27</li> | ||
+ | <li><b>Field of Study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Phenylalanine</li> | ||
+ | <li><b>Protein:</b> TIM Barrel</li> | ||
+ | <li><b>Favorite Scientist:</b> Elias James Corey</li> | ||
+ | <li><b>Project:</b> Pick up</li> | ||
+ | <li><b>Known as:</b> Landy (Lab Andy)</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/f/fa/MR_pic_Team_Lisa_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Lisa Engelsberger</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> TTAATCAGCGCA</li> | ||
+ | <li><b>Age:</b> 25</li> | ||
+ | <li><b>Field of study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Glycine</li> | ||
+ | <li><b>Protein:</b> TIM Barrel</li> | ||
+ | <li><b>Favorite Scientist:</b> Alexander von Humboldt</li> | ||
+ | <li><b>Project:</b> Provide</li> | ||
+ | <li><b>Known As:</b> Bavarian thunder</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/3/3e/MR_pic_Team_Tresor_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Trésor Kivoloka</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> ACGCGCGAATCCNNNAGG</li> | ||
+ | <li><b>Age:</b> 26</li> | ||
+ | <li><b>Field of Study:</b> Social Science</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Isoleucine</li> | ||
+ | <li><b>Protein:</b> TIM Barrel</li> | ||
+ | <li><b>Favorite Scientist:</b> Klaus Hurrelmann</li> | ||
+ | <li><b>Project:</b> Human Practices</li> | ||
+ | <li><b>Known As:</b> Dance Machine</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/c/c0/MR_pic_Team_Katrin_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Katrin Beuthert</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> AAAGCCACTAGAATCAAT</li> | ||
+ | <li><b>Age:</b> 21</li> | ||
+ | <li><b>Field of study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Selenocysteine</li> | ||
+ | <li><b>Protein:</b> Prion Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Clara Immerwahr</li> | ||
+ | <li><b>Project:</b> Wiki</li> | ||
+ | <li><b>Known as:</b> Wiki Wizard</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/c/cd/MR_pic_Team_Stuki_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Daniel Stukenberg</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GATGCGAACATCGAATTA</li> | ||
+ | <li><b>Age:</b> 22</li> | ||
+ | <li><b>Field of Study:</b> Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Valine</li> | ||
+ | <li><b>Protein:</b> Membrane Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Emil von Behring</li> | ||
+ | <li><b>Project:</b> Cut off</li> | ||
+ | <li><b>Known as:</b> Only true biologist</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/e/eb/MR_pic_Team_Alex_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Alexandra Richter</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GCCCTAGAANNN</li> | ||
+ | <li><b>Age:</b> 24</li> | ||
+ | <li><b>Field of study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Cysteine</li> | ||
+ | <li><b>Protein:</b> Zinc Finger</li> | ||
+ | <li><b>Favorite Scientist:</b> Johannes Kepler</li> | ||
+ | <li><b>Project:</b> Pick up</li> | ||
+ | <li><b>Known as:</b> Crystal girl</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/9/9d/MR_pic_Team_Andi_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Andreas Feser</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> A rhesus negative, allergic to birch pollen</li> | ||
+ | <li><b>Age:</b> 33</li> | ||
+ | <li><b>Field of Study:</b> Media studies</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Asparagine</li> | ||
+ | <li><b>Protein:</b> TIM Barrel</li> | ||
+ | <li><b>Favorite Scientist:</b> Marshall McLuhan</li> | ||
+ | <li><b>Project:</b> Human Practices, Graphics</li> | ||
+ | <li><b>Known As:</b> Mandy (Media Andy)</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/2/2b/MR_pic_Team_Sascha_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Sascha Grobe</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> AGTGCAAGCTGTCACGCG</li> | ||
+ | <li><b>Age:</b> 24</li> | ||
+ | <li><b>Field of Study:</b> Chemistry</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Methionine</li> | ||
+ | <li><b>Protein:</b> Membrane Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Johan Vaaler</li> | ||
+ | <li><b>Project:</b> Cut off</li> | ||
+ | <li><b>Known as:</b> Mr. Hoodie</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/7/70/MR_pic_Team_Maik_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Maik Luu</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> AUGGCCAUCAAA</li> | ||
+ | <li><b>Age:</b> 21</li> | ||
+ | <li><b>Field of Study:</b> Biomedical Science</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Lysine</li> | ||
+ | <li><b>Protein:</b> Membrane Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Jules Hoffmann</li> | ||
+ | <li><b>Known as:</b> Mr. SoLuution</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <span id="Ad" class="anni"></span> | ||
+ | <center><h1>Advisors</h1></center> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/1/15/MR_pic_Team_Anne_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Anne Löchner</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GCAAACAATGAA</li> | ||
+ | <li><b>Age:</b> 26</li> | ||
+ | <li><b>Field of Study:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Proline</li> | ||
+ | <li><b>Protein:</b> Membrane Protein</li> | ||
+ | <li><b>Favorite Scientist:</b> Rosalind Franklin</li> | ||
+ | <li><b>Project:</b> ILS/General Organization</li> | ||
+ | <li><b>Known as:</b> Mommy</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/a/a9/MR_pic_Team_Max_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Max Mundt</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> ATGGCANNN</li> | ||
+ | <li><b>Age:</b> 28</li> | ||
+ | <li><b>Field of Study:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Tryptophane</li> | ||
+ | <li><b>Protein:</b> Alcohol Dehydrogenase</li> | ||
+ | <li><b>Favorite Scientist:</b> Richard Dawkins</li> | ||
+ | <li><b>Project:</b> Cut off</li> | ||
+ | <li><b>Known As:</b> The Yeast Beast</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/d/d7/MR_pic_Team_Nico_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Nicolas Koutsoubelis</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> AACATCTGTNNN</li> | ||
+ | <li><b>Age:</b> 26</li> | ||
+ | <li><b>Field of Study:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> p-Benzoyl-L-phenylalanine</li> | ||
+ | <li><b>Protein:</b> Zinc Finger</li> | ||
+ | <li><b>Favorite Scientist:</b> Timothy Lu</li> | ||
+ | <li><b>Project:</b> Provide</li> | ||
+ | <li><b>Known As:</b> Daddy</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/2/20/MR_pic_Team_Olli_4p.jpeg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Oliver Schauer</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> O_TTGATCGTGGAACGT</li> | ||
+ | <li><b>Age:</b> 28</li> | ||
+ | <li><b>Field of Studies:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Cysteine</li> | ||
+ | <li><b>Protein:</b> Zinc Finger</li> | ||
+ | <li><b>Favorite Scientist:</b> Stephen Hawking</li> | ||
+ | <li><b>Project</b> Pick up</li> | ||
+ | <li><b>Known As:</b> Two face</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px;"><div style="float:left;"><img src="https://static.igem.org/mediawiki/2015/4/43/MR_pic_Team_DanielSchi_4p.jpeg" style="width:300px;margin-left:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;left:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Daniel Schindler</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GATGCGAACATCGAATTA</li> | ||
+ | <li><b>Age:</b> 30</li> | ||
+ | <li><b>Field of Study:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Selenocystein</li> | ||
+ | <li><b>Protein:</b> TIM Barrel</li> | ||
+ | <li><b>Favorite Scientist:</b> Gregor Mendel</li> | ||
+ | <li><b>Project:</b> Provide</li> | ||
+ | <li><b>Known As:</b> The Experienced</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | <figure> | ||
+ | <div style="position:relative; | ||
+ | display:inline-block; | ||
+ | margin-right:30px; | ||
+ | margin-bottom:30px; | ||
+ | width:900px; | ||
+ | padding:15px; | ||
+ | background:#F8F8F8; | ||
+ | border-style:solid; | ||
+ | border-color:#FF8F45; | ||
+ | border-width:2px; | ||
+ | border-radius:10px; | ||
+ | "><div style="float:right;"><img src="https://static.igem.org/mediawiki/2015/6/66/Team_DanielH%C3%BC_4p.jpg" style="width:300px;margin-right:5px;padding-top:5px;"></div> | ||
+ | <div style="position:absolute;text-align:justify;right:350px;padding-left:15px;padding-right:15px;width:550px;"> | ||
+ | <h1>Daniel Hürtgen</h1> | ||
+ | <p style="font-size:13pt;line-height:150%;text-align:left;"> | ||
+ | <ul style="list-style:none;"> | ||
+ | <li><b>My Sequence:</b> GATGCGAACATCGAATTA</li> | ||
+ | <li><b>Age:</b> 27</li> | ||
+ | <li><b>Field of Study:</b> PhD Student in Synthetic Biology</li> | ||
+ | <li><b>Favorite Amino Acid:</b> Glycine</li> | ||
+ | <li><b>Protein:</b> Zinc Finger</li> | ||
+ | <li><b>Favorite Scientist:</b> Craig Venter</li> | ||
+ | <li><b>Known As:</b> Protein Pro</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div></div></figure> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | <div style="position:absolute;text-align:center;z-index:2;background:#e0e0e0;line-height:150%;bottom:0px;padding-top:3px;margin-bottom:0px; padding-left:235px; padding-right:80px;min-height:60px;min-width:100%;max-width:100%;box-sizing:border-box;clear:both;"><!----> | ||
+ | <div> | ||
+ | <span style="margin-right:60px;"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/1/1d/MR_pic_syn.png" style="height:40px;padding:10px;"/> | ||
+ | </span> | ||
+ | <span> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/5/58/MR_pic_mpii.png" style="height:40px;padding:10px;"/> | ||
+ | </span> | ||
+ | <span style="margin-left:60px;"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/f/f0/MR_pic_unii.png" style="height:40px;padding:10px;"/> | ||
+ | </span> | ||
+ | </div> | ||
+ | <span style="font-size:8pt; color:white;"> iGEM Marburg - ZSM Karl-von-Frisch-Straße 16, D - 35043 Marburg</span> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </body> | ||
+ | |||
+ | </p> | ||
+ | <!-- | ||
+ | NewPP limit report | ||
+ | CPU time usage: 0.003 seconds | ||
+ | Real time usage: 0.003 seconds | ||
+ | Preprocessor visited node count: 4/1000000 | ||
+ | Preprocessor generated node count: 24/1000000 | ||
+ | Post‐expand include size: 0/2097152 bytes | ||
+ | Template argument size: 0/2097152 bytes | ||
+ | Highest expansion depth: 2/40 | ||
+ | Expensive parser function count: 0/100 | ||
+ | --> | ||
+ | |||
+ | <!-- Saved in parser cache with key 2015_igem_org:pcache:idhash:22958-0!*!*!*!*!*!* and timestamp 20160629082332 and revision id 413202 | ||
+ | --> | ||
+ | </div> <div class="visualClear"></div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </body> | ||
+ | </html> | ||
+ | <!-- end new wiki code ---> | ||
Revision as of 19:28, 29 June 2016
Team:Marburg/Members
![](https://static.igem.org/mediawiki/2015/1/1c/MR_pic_Sidebanner_Home.png)
![](https://static.igem.org/mediawiki/2015/e/e5/MR_pic_Button_Members.png)
Students
![](https://static.igem.org/mediawiki/2015/9/9b/MR_pic_Team_Anna_4p.jpeg)
Anna Knörlein
- My Sequence: GCAAACAACGCA
- Age: 23
- Field of Study: Chemistry
- Favorite Amino Acid: Phenylalanine
- Protein: Membrane Protein
- Favorite Scientist: Richard P. Feynman
- Project: ILS/Measurement
- Known As: Master of Organization
![](https://static.igem.org/mediawiki/2015/0/05/MR_pic_Team_Matthias_4p.jpeg)
Matthias Franz
- My Sequence: ATGGCCACCACTCATATTGCTAGC
- Age: 23
- Field of Study: Chemistry
- Favorite Amino Acid: Arginine
- Protein: Zinc Finger
- Favorite Scientist: Richard Dawkins
- Project: Provide
- Known as: The Grammar N... Nerd
![](https://static.igem.org/mediawiki/2015/4/47/MR_pic_Team_Andy_4p.jpeg)
Andreas Herdlitschka
- My Sequence: GCAAACGACTAT
- Age: 27
- Field of Study: Chemistry
- Favorite Amino Acid: Phenylalanine
- Protein: TIM Barrel
- Favorite Scientist: Elias James Corey
- Project: Pick up
- Known as: Landy (Lab Andy)
![](https://static.igem.org/mediawiki/2015/f/fa/MR_pic_Team_Lisa_4p.jpeg)
Lisa Engelsberger
- My Sequence: TTAATCAGCGCA
- Age: 25
- Field of study: Chemistry
- Favorite Amino Acid: Glycine
- Protein: TIM Barrel
- Favorite Scientist: Alexander von Humboldt
- Project: Provide
- Known As: Bavarian thunder
![](https://static.igem.org/mediawiki/2015/3/3e/MR_pic_Team_Tresor_4p.jpeg)
Trésor Kivoloka
- My Sequence: ACGCGCGAATCCNNNAGG
- Age: 26
- Field of Study: Social Science
- Favorite Amino Acid: Isoleucine
- Protein: TIM Barrel
- Favorite Scientist: Klaus Hurrelmann
- Project: Human Practices
- Known As: Dance Machine
![](https://static.igem.org/mediawiki/2015/c/c0/MR_pic_Team_Katrin_4p.jpeg)
Katrin Beuthert
- My Sequence: AAAGCCACTAGAATCAAT
- Age: 21
- Field of study: Chemistry
- Favorite Amino Acid: Selenocysteine
- Protein: Prion Protein
- Favorite Scientist: Clara Immerwahr
- Project: Wiki
- Known as: Wiki Wizard
![](https://static.igem.org/mediawiki/2015/c/cd/MR_pic_Team_Stuki_4p.jpeg)
Daniel Stukenberg
- My Sequence: GATGCGAACATCGAATTA
- Age: 22
- Field of Study: Biology
- Favorite Amino Acid: Valine
- Protein: Membrane Protein
- Favorite Scientist: Emil von Behring
- Project: Cut off
- Known as: Only true biologist
![](https://static.igem.org/mediawiki/2015/e/eb/MR_pic_Team_Alex_4p.jpeg)
Alexandra Richter
- My Sequence: GCCCTAGAANNN
- Age: 24
- Field of study: Chemistry
- Favorite Amino Acid: Cysteine
- Protein: Zinc Finger
- Favorite Scientist: Johannes Kepler
- Project: Pick up
- Known as: Crystal girl
![](https://static.igem.org/mediawiki/2015/9/9d/MR_pic_Team_Andi_4p.jpeg)
Andreas Feser
- My Sequence: A rhesus negative, allergic to birch pollen
- Age: 33
- Field of Study: Media studies
- Favorite Amino Acid: Asparagine
- Protein: TIM Barrel
- Favorite Scientist: Marshall McLuhan
- Project: Human Practices, Graphics
- Known As: Mandy (Media Andy)
![](https://static.igem.org/mediawiki/2015/2/2b/MR_pic_Team_Sascha_4p.jpeg)
Sascha Grobe
- My Sequence: AGTGCAAGCTGTCACGCG
- Age: 24
- Field of Study: Chemistry
- Favorite Amino Acid: Methionine
- Protein: Membrane Protein
- Favorite Scientist: Johan Vaaler
- Project: Cut off
- Known as: Mr. Hoodie
![](https://static.igem.org/mediawiki/2015/7/70/MR_pic_Team_Maik_4p.jpeg)
Maik Luu
- My Sequence: AUGGCCAUCAAA
- Age: 21
- Field of Study: Biomedical Science
- Favorite Amino Acid: Lysine
- Protein: Membrane Protein
- Favorite Scientist: Jules Hoffmann
- Known as: Mr. SoLuution
Advisors
![](https://static.igem.org/mediawiki/2015/1/15/MR_pic_Team_Anne_4p.jpeg)
Anne Löchner
- My Sequence: GCAAACAATGAA
- Age: 26
- Field of Study: PhD Student in Synthetic Biology
- Favorite Amino Acid: Proline
- Protein: Membrane Protein
- Favorite Scientist: Rosalind Franklin
- Project: ILS/General Organization
- Known as: Mommy
![](https://static.igem.org/mediawiki/2015/a/a9/MR_pic_Team_Max_4p.jpeg)
Max Mundt
- My Sequence: ATGGCANNN
- Age: 28
- Field of Study: PhD Student in Synthetic Biology
- Favorite Amino Acid: Tryptophane
- Protein: Alcohol Dehydrogenase
- Favorite Scientist: Richard Dawkins
- Project: Cut off
- Known As: The Yeast Beast
![](https://static.igem.org/mediawiki/2015/d/d7/MR_pic_Team_Nico_4p.jpeg)
Nicolas Koutsoubelis
- My Sequence: AACATCTGTNNN
- Age: 26
- Field of Study: PhD Student in Synthetic Biology
- Favorite Amino Acid: p-Benzoyl-L-phenylalanine
- Protein: Zinc Finger
- Favorite Scientist: Timothy Lu
- Project: Provide
- Known As: Daddy
![](https://static.igem.org/mediawiki/2015/2/20/MR_pic_Team_Olli_4p.jpeg)
Oliver Schauer
- My Sequence: O_TTGATCGTGGAACGT
- Age: 28
- Field of Studies: PhD Student in Synthetic Biology
- Favorite Amino Acid: Cysteine
- Protein: Zinc Finger
- Favorite Scientist: Stephen Hawking
- Project Pick up
- Known As: Two face
![](https://static.igem.org/mediawiki/2015/4/43/MR_pic_Team_DanielSchi_4p.jpeg)
Daniel Schindler
- My Sequence: GATGCGAACATCGAATTA
- Age: 30
- Field of Study: PhD Student in Synthetic Biology
- Favorite Amino Acid: Selenocystein
- Protein: TIM Barrel
- Favorite Scientist: Gregor Mendel
- Project: Provide
- Known As: The Experienced
![](https://static.igem.org/mediawiki/2015/6/66/Team_DanielH%C3%BC_4p.jpg)
Daniel Hürtgen
- My Sequence: GATGCGAACATCGAATTA
- Age: 27
- Field of Study: PhD Student in Synthetic Biology
- Favorite Amino Acid: Glycine
- Protein: Zinc Finger
- Favorite Scientist: Craig Venter
- Known As: Protein Pro
![](https://static.igem.org/mediawiki/2015/1/1d/MR_pic_syn.png)
![](https://static.igem.org/mediawiki/2015/5/58/MR_pic_mpii.png)
![](https://static.igem.org/mediawiki/2015/f/f0/MR_pic_unii.png)
</html>