Difference between revisions of "Team:Toronto/Notebook-w01-thu"
(Created page with "<html> <!-- ####################################################### --> <!-- # This html was produced by the igemwiki generator # --> <!-- # https://github.com/igemuoftATG...") |
|||
| Line 6: | Line 6: | ||
<!-- repo for this wiki: https://github.com/igemuoftATG/wiki2016 --> | <!-- repo for this wiki: https://github.com/igemuoftATG/wiki2016 --> | ||
| − | <!-- file built: Wed Oct 19 2016 03: | + | <!-- file built: Wed Oct 19 2016 03:42:14 GMT+0000 (UTC) --> |
</html> | </html> | ||
Revision as of 03:44, 19 October 2016
console.js:26
Week 1: May 19, 2016
Thursday, 5/19/2016
Final adjustments to the RRF
●
Addition to the 5B.1 section with regards to D.Acidovorans and 5B.6 section with chemical burns and hazards from off-gases/by-products.
●
Updates on PPE (face shield) and Cryogenics - Gas Law Calculation sheet.
Budget management: pending on access to the account on UofT Medstore.
●
In search for previous year receipts - Bohdan searched the lab- receipts were not found.
Research on BACs (Bacteria Artificial Chromosomes):
●
Commercially available BACs:
●
General research in to protocol design (please see new Protocol)
Explore Delftibactin options:
●
In search for potential promoters on the del cluster as a possible route of increasing delftibactin production in D. acidovorans.
●
Promoter prediction programs used including Bprom, etc...
●
Scanning the potential promoters on the genome of Delftia acidovorans using Benchling.
●
Possibility of CRISPR utilization for promoters alternation in NMR collaboration with Dr. Rudraksha Dutta Majumdar (UTSC).
Explore the plasmid design for the sensing project:
- GolB promoter
GolB promoter: cttgaccttccaacactggcaaggtccagactggcaa
- GolS gene: (http://www.genome.jp/dbget-bin/www_bget?stm:STM0354) [465 nucleotides]
atgaacatcggtaaagcagctaaagcatcgaaagtctcggccaaaatgattcgctactat
gaacagattggtctgattcccgcggcaagtcggacggattccggctatcgggcctatacc
caggctgatgttaatcaattgcattttatacgccgcgcgcgcgacctcggtttttcagtt
gctgaaatcagcgacttactgaatctttggaataaccagtcgcggcaaagcgctgacgtc
aaacgcctggcgcagacgcacattgatgaactggacagacgtatccagaacatgcagcac
atggcgcaaaccctcaaagcgctgattcactgctgcgccggcgacgcgctgccagattgc
cccattctgcatacgcttggacaacctgacgatagcgagccggaggcgcgtaccggagcg
gtattgcgacgtcctcgtcgccacggactggcaaagcgtctgtaa
- BioBrick compatible parts must not have the following restriction sites (All these restriction sites belong to the prefix and suffix of the BioBrick assembly standard):
A | B | C | |
1 | Sequence | Type | Enzyme |
2 | gaattc | Illegal | EcoRI |
3 | tctaga | Illegal | XbaI |
4 | actagt | Illegal | SpeI |
5 | ctgcag | Illegal | PstI |
6 | gcggccgc | Avoid | NotI |
Table1
- Proposed blueprint of sensing plasmid (likely missing a UNS before suffix; please confirm)
Agenda for May 20:
●
Dr. Radhakrishnan Mahadevan interview from 3-4 pm.
●
Remember to print out the Experiment Flow Chart - Facebook group files, Safety Training Certificate & refresher.
●
Study the RRF for the interview.
