Difference between revisions of "Team:FAFU-CHINA/Notebook"

Week 1 (5.16-5.22）

Before thefirst week, we cultivated Chlamydomonasreinhardtii.

We sent our reserved parts to SYSU-CHINAteam and ShanghaiTechChina_B team to help them to finish project.

BBa-k325903       Plate1       2L

BBa-k 415023      Plate1       2P

BBa-k325909       Plate1       4L     

BBa-k934012       Plate1       5H

BBa-k934022       Plate1       5J        

BBa-k934026       Plate1       5L

BBa-k516011       Plate1       9G

BBa-k546001       Plate1      12F

BBa-k584002       Plate1      13E          

BBa-k594001       Plate1      18I

BBa-k381001       Plate1       4B

BBa- E0040         Plate4       13L

Wedistributed questionnaires about mosquito-borne diseases in China.

 

Week 2（5.23-5.29）

We designed primers for  Cry4a,Cry10a, Cry11a,Cyt1,Cyt2,EGFP genes.The genes from Bacillus thuringiensis serovar israelensis strain BRC-LLP29

Name                                Sequence                                                                             length

Cry11Aa4-In-BglII-Short-F CCATACAGTTCTAGAGAATGAATTATATGGAAGATAGT     38

Cry11Aa4-In-NdeI-Short-R CGGAGCGGAATCATATCGGATTAAT                                  25

Cry4Aa4-In-BglII-Short-F   CCATACAGTTCTAGAGAATGAATCCTTATCAAAATAAA      38

Cry4Aa4-In-NdeI-Short-R  CGGAGCGGAATCATATTCACTCG                                      23

Cry10Aa4-In-BglII-Short-F CCATACAGTTCTAGAGAATGAATCCATATCAAAATAAG      38

Cry10Aa4-In-NdeI-Short-R CGGAGCGGAATCATATATACAGATTGA                             27

Cry4b-In-BglII-Short-F       CCATACAGTTCTAGAGAATGTGTGAAAATAACCAA            35

Cry4b-In-NdeI-Short-R      CGGAGCGGAATCATATTTATTTTGA                                   25

Cyt1-In-BglII-Short-F         CCATACAGTTCTAGAGAATGGAAAATTTAAATCATTGT      38

Cyt1-In-NdeI-Short-R        CGGAGCGGAATCATATTTAGAGGGT                                 25

Cyt2-In-BglII-Short-F         CCATACAGTTCTAGAGAATGCACCTTAATAATTTGAAT      38

Cyt2-In-NdeI-Short-R        CGGAGCGGAATCATATTTATTTTATTGG                            28

EGFP-In-BglII-F                CCATACAGTTCTAGAGAATGGTGAGCAAG                        29

EGFP-In-NdeI-R                CGGAGCGGAATCATATCTTGTACAG                                  25

Week 3（5.30-6.5）

Molecular cloning of Cry4a,Cry4b,Cry10a,Cry11a,Cyt1,Cyt2,EGFP genes.Vector is pChlamy-3.

PCR

                                                                                   goto         cycles

1              Pre-denaturation       94°C         2min                             

2              Denaturation            98°C         10sec                           

3              Extension                 68°C         30 sec/kb     2              25~45

4              Final Extension        68°C         5min                              

               template        Product length    Result

Cry11A    Bt-1              1959bp            X

Cry4Aa    Bt-1              3573bp            X

Cry4b      Bt-1              1818bp            X

Cry10A    Bt-1              2058bp            X

Cyt1        Bt-1              780bp              X

Cyt2        Bt-1              819bp              X

EGFP      pK7GWF2     747bp              √

Analysis of Negative Result： Annealingreaction was not set.

Week 4(6.6-6.11)

PCR

                                                                                   goto         cycles

1              Pre-denaturation       94°C         2min                             

2              Denaturation            98°C         10sec                           

3              Annealing                 58℃         30sec                            

4              Extension                 68°C         30 sec/kb     2              25~45

5              Final Extension        68°C         5min                              

                                                  Product length   Result

M         Trans2KPlus DNA Ladder                                

1          Cry11A            Bt-2        1959bp        √

2          Cry4Aa            Bt-2        3573bp         

3          Cry10A            Bt-2        2058bp        √

4          Cry4b              Bt-2        1818bp        √

5          Cyt1                Bt-2        780bp         √

6          Cyt2                Bt-2        819bp         √

7          Cry11A            Bt-3        1959bp        √（Non-specific）

8          Cry4Aa            Bt-3        3573bp         

10        Cry10A            Bt-3        2058bp        √（Non-specific）

9          Cry4b              Bt-3        1818bp         

11        Cyt1                Bt-3        780bp         √（Non-specific）

12        Cyt2                Bt-3        819bp         √

13        Cry11A            Bt-4        1959bp        X（Non-specific）

14        Cry4Aa            Bt-4        3573bp        （Non-specific）

16        Cry10A            Bt-4        2058bp        √（Non-specific）

15        Cry4b              Bt-4        1818bp        √（Non-specific）

17        Cyt1                Bt-4        780bp         √（Non-specific）

18        Cyt2                Bt-4        819bp         √（Non-specific）

M         Trans2KPlus DNA Ladder                                

1          Cry11A            Colony    1959bp        X

2          Cry4Aa            Colony    3573bp        X

3          Cry4b              Colony    1818bp        √

4          Cry10A            Colony    2058bp        X

5          Cyt1                Colony    780bp         X

6          Cyt2                Colony    819bp         √

7          Cry11A            Colony    1959bp        X

8          Cry4Aa            Colony    3573bp        X

9          Cry4b              Colony    1818bp        X

10        Cry10A            Colony    2058bp        X

11        Cyt1                Colony    819bp         √

12        Cyt2                Colony    1959bp        √

M         Trans2KPlus DNA Ladder                                

PCR

                                                                                   goto         cycles

1              Pre-denaturation       94°C         2min                             

2              Denaturation            98°C         10sec                           

3              Annealing                 58℃         30sec                            

4              Extension                 68°C         30 sec/kb     2              25~45

5              Final Extension        68°C         5min                              

                             template        Primer-F            Primer-R            Product length   Result

1            EGFP      pK7GWF2     EGFP-In-BglII-F EGFP-In-NdeI-R 747bp                 √

2            EGFP      pK7GWF2     EGFP-In-BglII-F EGFP-In-NdeI-R 747bp                 √

Gel Extraction

                                Result

1              EGFP       √

2              EGFP       √

estriction enzyme digestion

                enzyme          template

1              BglII&NdeI     pChlamy-3

2              BglII&NdeI     pChlamy-3

Purificationof enzyme digest product

In-Fusion

10μl          TotalVolume

2 μl          5XIn-Fusion HD Enzyme Premix

3μl           LinearizedVector

4μl           PurifiedPCR Fragment

1μl           dH2O(as needed)

Incubate the reaction for 15 min at 50°C, then place on ice.

Continue to the TransformationProcedure.

1              EGFP+pChlamy_3

2              EGFP+pChlamy_3

Week 5(6.12-6.18)

On 17th June, Junhao visited theShenzhen University and their team (SZU-China) after Synthesis Biology Meeting.

PCR：Cry4a,Cry10a, Cry11a,Cyt1,Cyt2

Agarosegel electrophoresis

Purificationof PCR product or Gel extract

Gelextraction

Doubleenzyme digest of plasmid

Purificationof enzyme digest product

Agarosegel electrophoresis

In-fusion

Transformation

Week 6(6.19-6.25)

We try to UV irradiation of Bacillusthuringiensis, We need to determine the Bacillus thuringiensis concentration.

Production of summer anti-mosquitohandbook

Week 7 (6.26-7.2)

UV irradiation of Bacillus thuringiensis.

Week 8 (7.3-7.9)

UV irradiation of Bacillus thuringiensis.

We completed the first edition of thehandbook.

Week 9(7.10-7.16)

Codon optimization of Chlamydomonas reinhardtii by synbio-tech

Week 10(7.17-7.23)

Gene synthesis by synbio-tech

Week 11(7-24.7.30)

Cloning of the genes with codonoptimization in Chlamydomonas reinhardtii  ，Vector is pChlamy-3.

Week 12(7.31-8.6)

We got a chance to study at departmentof Health Education in Jiangxi Provincial Institute of Parasitic Disease forhalf a day.
 

Week 13(8.7-8.13)

We noticed that the fluorescence valuein treatment group was higher than the positive control group about JNFLS-CHINAhigh school team’s project. We had a talk about it by social media. To explorethe potential cause, we advised them to use Flow Cytometer (FCM) to gatherdata. And we helped them design the protocol of experiment with details. If youare interested in the details, you can visit this link: <a href="https://2016.igem.org/Team:JNFLS_China/experiments">https://2016.igem.org/Team:JNFLS_China/experiments</a> and results

Week 14(8.14-8.20)

During the G20 Summit held in Hangzhou,we shared our labs with them in summer.

Week 15(8.21-8.27)

We Identified the production of theclone.

Transforming Chlamydomonas reinhardtii by Electroporation.

Week 16(8.28-9.3)

We used confocal microscopy to observethe expression of GFP, and this transformation was negative.

We participated in the CCIC (CentralChina iGEM Consortium) held in Zhongshan University in Guangzhou.

Week 17(9.4-9.10)

Transforming Chlamydomonas reinhardtii by Electroporation again.

Week 18(9.11-9.17)

 We helped NEU-China to test theexpression of tCas9-CIBN and got the accurate data about the inducedconcentration of arabinose.

Week 20(9.18-9.24)

We screened the transformants of C. reinhardtii. The greens in the figureare positive for transformation.

We designed the qPCR primers use ofdetection Cry4a,Cry10a,Cry11a,Cyt1,Cyt2 genes expression.

cry4a-qPCR1-F-133       ACGACCAGATGGAGGCCAAG     20

cry4a-qPCR1-R-133       TACTGGATCTGGGCCAGGGT     20

cry4a-qPCR2-F-70         CCAGGACAGCCACCAGTTCA      20

cry4a-qPCR2-R-70         CACGCCGATGTTCTCGTTGG      20

cry10a-qPCR1-F-94       CGCAACAAGCCCATCGACAA      20

cry10a-qPCR1-R-94       CCTCGCTGCTGTTGCTGAAG      20

cry10a-qPCR2-F-84       TTCGGCTACGTGACCTTCCC      20

cry10a-qPCR2-R-84       GGTGCCGTACAGGGTCATCA     20

cry11a-qPCR1-F-85       CGAGTGGGTGGACTTCGTGA     20

cry11a-qPCR1-R-85       GATGCTGAACAGGGCGTTGG     20

cry11a-qPCR2-F-69       CCAACGCCCTGTTCAGCATC      20

cry11a-qPCR2-R-69       ACAGCTGGCTCAGGTACCAC      20

cyt1-qPCR1-F-136         ACAACGTGCTGTTCGCCATC      20

cyt1-qPCR1-R-136         TTGTAGCTGGCGGAGTCCTG     20

cyt1-qPCR2-F-123         AACAAGGTGCTGGAGGTGCT     20

cyt1-qPCR2-R-123         GGCCTCGTTCTTCTGGGTGT      20

cyt2-qPCR1-F-137         CAGACCATCGAGGTGAGCGT     20

cyt2-qPCR1-R-137         GGCTCCAGGTTGGTGAAGGT     20

cyt2-qPCR2-F-99           GCCTTCGAGATCACCGTGGA     20

cyt2-qPCR2-R-99           CACGGTCAGGGCCTTCATCT      20

egfp-qPCR1-F-64           GGCCACAAGTTCAGCGTGAG     20

egfp-qPCR1-R-64           TCAGGGTCAGCTTGCCGTAG     20

egfp-qPCR2-F-140         GCCGACAAGCAGAAGAACGG     20

egfp-qPCR2-R-140         TAGTGGTTGTCGGGCAGCAG     20

Week 21(9.25-10.1)

Week 22(10.2-10.8)

ExtractRNA

RT-PCR

QPCR

Week 23(10.9-10.15)