Chilam Poon (Talk | contribs) |
Chilam Poon (Talk | contribs) |
||
Line 31: | Line 31: | ||
<p> | <p> | ||
− | 1) <b><i>Mcl1</i> promoter<b> | + | 1) <b><i>Mcl1</i> promoter</b> |
− | The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA< | + | The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</p>CATGATGGTCTAGGGAACG ) |
Revision as of 08:45, 19 October 2016
1) Mcl1 promoter The Mcl1 promoter region with Mcl1 mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAAGCGGCCGC
CATGATGGTCTAGGGAACG ) 2) KR 3) Antibiotics 4) hemolymph end