Chilam Poon (Talk | contribs) |
Chilam Poon (Talk | contribs) |
||
Line 33: | Line 33: | ||
1) <b><i>Mcl1</i> promoter</b> | 1) <b><i>Mcl1</i> promoter</b> | ||
− | The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</ | + | The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</font>CATGATGGTCTAGGGAACG ) |
Revision as of 08:46, 19 October 2016
1) Mcl1 promoter The Mcl1 promoter region with Mcl1 mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAAGCGGCCGCCATGATGGTCTAGGGAACG ) 2) KR 3) Antibiotics 4) hemolymph end