Difference between revisions of "Team:NYMU-Taipei/Project-Experiment"

Line 33: Line 33:
 
1) <b><i>Mcl1</i> promoter</b>
 
1) <b><i>Mcl1</i> promoter</b>
  
The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</p>CATGATGGTCTAGGGAACG )
+
The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</font>CATGATGGTCTAGGGAACG )
  
  

Revision as of 08:46, 19 October 2016

1) Mcl1 promoter The Mcl1 promoter region with Mcl1 mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAAGCGGCCGCCATGATGGTCTAGGGAACG ) 2) KR 3) Antibiotics 4) hemolymph end