|
|
| (96 intermediate revisions by 3 users not shown) |
| Line 1: |
Line 1: |
| − | {{British_Columbia_2}}
| |
| − | <html lang="en">
| |
| − | <head>
| |
| − | <title>S-Layer</title>
| |
| − | <meta charset="utf-8">
| |
| − | <meta name="viewport" content="width=device-width, initial-scale=1">
| |
| − | <style>
| |
| − | .cover{
| |
| − | background: url("https://static.igem.org/mediawiki/2016/6/60/T--British_Columbia--header-mountains.jpg");
| |
| − | background-size: cover; background-repeat: no-repeat;
| |
| − | }
| |
| | | | |
| − | @media screen and (min-width: 768px) {
| |
| − | .cover{
| |
| − | background-position: 0 -350px;
| |
| − | }
| |
| − | }
| |
| − |
| |
| − | .content-wrap{
| |
| − | position: relative;
| |
| − | height: 2000px;
| |
| − | background-color: white;
| |
| − | padding-left: 25px; padding-right: 25px;
| |
| − | width: 100vw; max-width: 100%;
| |
| − | }
| |
| − |
| |
| − | .yellow{
| |
| − | color: yellow;
| |
| − | }
| |
| − |
| |
| − | </style>
| |
| − | </head>
| |
| − | <body>
| |
| − | <div class="cover">
| |
| − | <div class="container-fluid">
| |
| − | <div class="row" id="title">
| |
| − | <div class="col-sm-12">
| |
| − | <strong><p style="font-size: 3em">S-Layer Engineering</p></strong>
| |
| − | </div>
| |
| − | </div><!--title-->
| |
| − | </div><!--container-fluid-->
| |
| − | </div><!--cover-->
| |
| − | <div class="content-wrap">
| |
| − | <h3></h3>
| |
| − | <h2 class="page-header">Abstract</h2>
| |
| − | <p>Lignocellulosic biomass,the most abundant renewable resources in nature, represents a promising alternative to fossil fuels for sustainable production of chemicals and material. However, the main technological obstacle for industrial exploitation of biomass is the recalcitrant nature of lignocellulosic polymers. One approach to harness the energy contained in biomass is to convert the lignocellulosic polymers in simple sugars, which can be further transformed in valuable compounds, using microorganisms. Some anaerobic microorganisms have developed approaches to break down recalcitrant plant biomass using elaborate extracellular enzyme complexes, containing a scaffolding protein with many attached cellulolytic enzymes. The assembly of such complexes requires engineering of highly specific cohesin-dockerin interactions.
| |
| − | Our approach focuses on adapting the surface layer of Caulobacter crescentus for the for highly efficient display of cellulolytic enzymes. We specifically chose C. crescentus as it natively expresses a two dimensional crystal lattice protein called a surface layer (S-Layer), which can be engineered to work as an enzyme display. Our goals were to embed cellulolytic enzymes into the S-Layer protein to confirm their proper folding and activity. We believe that our approach will simplify the process of "cellulosome" engineering by exploiting the robust secretion and display system of Caulobacter. The developed platform can be easily adapted for the display of different enzymatic activities.
| |
| − | </p>
| |
| − | <h2 class="page-header">Key Achievements</h2>
| |
| − | <ul style="font-size: 13px">
| |
| − | <li>Cloned 5 different cellulase constructs, such as β-1,4-endoglucanase (Endo5A), β-1,4-glucosidase (Gluc1C), β-1,4-exoglucanase (cex) and 2 versions of β-1,4-endoglucanase(E1) in p4A723 plasmid containing rsaA protein and transformed into C. crescentus for the display on cell surface.</li>
| |
| − | <li>Cloned 4 different cellulases - Endo5A, Gluc1C, E1, G12, cex into pSB1C3 and submitted as parts BBa…… </li>
| |
| − | <li>Confirmed surface protein (rsaA)-cellulase fusion proteins expression of Endo5A, Gluc1C, E1_422, E1_399 constructs</li>
| |
| − | <li>Confirmed increased cellulase activity of Endo5A, Gluc1C, E1_422, E1_399 cellulase constructs expressed on surface of C. crescentus</li>
| |
| − | <li> Confirmed baseline intracellular cellulase activity of 4 different cellulase constructs expressed in E. coli: Endo5A, Gluc1C, E1, Gluc1C</li>
| |
| − | <li>Codon-optimized β-1,4-endoglucanase (cenA) derived from Registry for expression in Caulobacter. Confirmed its expression and cellulase activity on the surface of Caulobacter</li>
| |
| − | </ul>
| |
| − | <h2 class="page-header">Design</h2>
| |
| − | <h2 class="page-header">Methods</h2>
| |
| − | <h3>Cloning of cellulase enzymes into rsaA plasmid in C. crescentus</h3>
| |
| − | <p>The synthesized cellulase DNA was amplified using PCR with HF Phusion polymerase in 100 μl reactions using the following primers to add the Bgl II, Pst cut sites for cloning in p4A_723 plasmid:</p>
| |
| − | <p>endo5a_34_fwd (5’-TCCAGATCTAGCGTCAAGGGGTATTACCAC) and endo5a_385_rev(5’-TCCATCTGCAGACACCGGCTTCATGATCCG) primers for Endo5A construct.<br>
| |
| − | Gluc1c_4_fwd (5’- TCCAGATCTAACACGTTCATCTTTCCGGC) and gluc1c_448_rev (5’-TCCATCTGCAGAGAACCCGTTCTTGGCCAT) primers for Gluc1C construct.<br>
| |
| − | E1_42_fwd (5’ - TCCAGATCTGTTGCAGGCGGGGGTTATTG) and E1_422_rev (5’-TCCATCTGCAGATGAGGGGGAGGGAGAC) for E1_422 construct. And E1_42_fwd and E1_399_rev (5’-TCCATCTGCAGAAACCGGGTCAAATATCGATGATTTTATC) for E1_399 construct.<br>
| |
| − | G12_35_fwd (5’-TCCAGATCTGCGACGACCTCCACG) and G12_274_rev (5’- TCCATCTGCAGATGAGGGGGTGGGAGTAG) for G12 construct.
| |
| − | </p>
| |
| − | <p>pSB1C3 high copy assembly plasmid was <a href="#">digested</a> using ___ and ___ restriction enzymes while Endo5A, Gluc1C, E1, G12, and CEX were <a href="#">digested</a> using ___ and ___ restiction enzymes. The plasmid digest was then purified by agarose gel purification using ____ kit while the gene digest was purified by PCR purification using ___ kit. Both purified digest were <a href="#">ligated</a> together and ligation mix was then transformed in chemically competent dh5a E. coli. <p>
| |
| − | <p>
| |
| − | For the cloning of CEX: P4A723 rsaA plasmid and was <a href="#">digested</a> using Bgl II and Nhe I restriction enzymes while CEX was <a href="#">digested</a> using Bll II and Nhe I restiction enzymes. The plasmid digest was then purified by agarose gel purification using ____ kit while the gene digest was purified by PCR purification using ___ kit. Both purified digest were <a href="#">ligated</a> together and ligation mix was then transformed in chemically competent dh5a E. coli.
| |
| − | </p>
| |
| − | <p>
| |
| − | Transformed colonies were then plated on and selected from a LB-CM plate and grown overnight in LB-CM media. Recombinant plasmid was then removed using ,a href="#">QIAGEN</a> miniprep kit and sent for sequence confirmation.</p>
| |
| − |
| |
| − | <p>
| |
| − | After sequence confirmation, the mini preped plasmids were electroporated into electro compitent C. Crescentus and colonies were grown on a PYE-CM plate. One colony was selected and streaked onto a fresh plate, which would be used for all future assays. </p>
| |
| − |
| |
| − |
| |
| − | <h3>
| |
| − | Cloning of cellulase enzymes into psb1c3 with ptac promoter and rbs
| |
| − | </h3>
| |
| − | <p>
| |
| − | Synthesized cellulase enzymes were amplified using high fidelity <a href="#'>phusion polymerase chain reaction</a>. Cellulase enzymes were amplified in 100 ul reactions using the following primers to add the bio bricking cut sites (EcoR I, Xba I, Spe I, and Pst I):
| |
| − |
| |
| − | Endo5A Primers: AAAAAAAAAAAAAAAAAAAAA
| |
| − |
| |
| − | Gluc1C Primers: AAAAAAAAAAAAAAAAAAAAA
| |
| − |
| |
| − | E1 Primers: AAAAAAAAAAAAAAAAAAAAA
| |
| − |
| |
| − | G12 Primers: AAAAAAAAAAAAAAAAAAAAA
| |
| − |
| |
| − | CEX Primeers: AAAAAAAAAAAAAAAAAAAAA
| |
| − |
| |
| − | </p>
| |
| − | <p>
| |
| − | pSB1C3 high copy assembly plasmid was digested using ___ and ___ restriction enzymes while Endo5A, Gluc1C, E1, G12, and CEX were digested using ___ and ___ restiction enzymes. The plasmid digest was then purified by agarose gel purification using ____ kit while the gene digest was purified by PCR purification using ___ kit. Both purified digest were ligated together and ligation mix was then transformed in chemically competent dh5a E. coli.
| |
| − | </p>
| |
| − | <p>
| |
| − | Transformed colonies were then plated on and selected from a LB-CM plate and grown overnight in LB-CM media. Recombinant plasmid was then removed using QIAGEN miniprep kit and sent for sequence confirmation.
| |
| − | </p>
| |
| − |
| |
| − | <p>
| |
| − | Biobricked pTAC and RBS parts ___ and ___ were PCR amplified using a high fidelty phusion polymerase chain reaction using these primers: AAAAAAAAAAAAAA. </p>
| |
| − |
| |
| − | <p>
| |
| − | The amplified pTAC and RBS part was then digested using ___ and ___ restiction enzymes. pSB1C3 high copy assembly plasmid with the gene insert was digested using ___ and ___ restriction enzymes. The plasmid digest was then purified by agarose gel purification using ____ kit while the pTAC RBS digest was purified by PCR purification using ___ kit. Both purified digest were ligated together and ligation mix was then transformed in chemically competent dh5a E. coli.</p>
| |
| − |
| |
| − | <p>
| |
| − | Transformed colonies were then plated on and selected from a LB-CM plate and grown overnight in LB-CM media. Recombinant plasmid was then removed using QIAGEN miniprep kit and sent for sequence confirmation. </p>
| |
| − | <h3>surface layer fusion protein extraction</h3>
| |
| − | <p>
| |
| − | 10 mL tubes of PYE-CM were inoculated with the different C. crescentus strains carrying the different cellulase fusion rsaA plasmid as well as a positive control carrying an empty rsaA plasmid and a negative control of rsaA- C. crescentus. Cultures were grown overnight at 30°C shaking. Cultures were taken out of incubator and optical density at 600 nm was measured. All cultures were then normalized to the lowest OD by diluting the remaining culture with PYE. </p>
| |
| − |
| |
| − | <p>
| |
| − | <a href="#">Low pH extraction (Walker et al. 1992)</a> was performed using different pHs of HEPES buffer to remove only crystalline s-layer without lysing cells. Proteins were then stored in epindorf tubes at -20°C to be used at a later date. </p>
| |
| − |
| |
| − | <h3>
| |
| − | Surface layer fusion protein expression confirmation </h3>
| |
| − | <h3>
| |
| − | Caulobacter Cellulase Activity Analysis</h3>
| |
| − | <p>
| |
| − | For cellulase enzyme activity measurement, triplicate 5mL PYE-CM starter cultures were grown at 30°C in 10 mL tubes shaking for 2 days. Cultures were taken out of incubator and optical density at 600 nm was measured. All cultures were then normalized to the lowest OD 600 nm by diluting the remaining culture with PYE. 1 mL of each sample was removed and washed 3 times with fresh PYE to remove and lysed cells that may interfere with cellulase activity results. </p>
| |
| − |
| |
| − | <p>
| |
| − | Two separate conditions were tested using the <a href="#">Cellulase Activity Assay Protocol adopted from</a> (): one with washed cells and the other with unwashed cells (all samples had been normalized previously). 150 uL of culture from the two separate conditions were aliquoted into a clear 96 well plate then 150 uL assay mix (0.1 mg/ml DNPC in xx M pH 5.5 potassium acetate buffer) was added into the each occupied well. </p>
| |
| − |
| |
| − | <p>
| |
| − | OD 400 nm was measured every 30 minutes for 5 hours by an XX plate reader. Between measurements the culture was incubating at 30°C. </p>
| |
| − |
| |
| − | <h3>
| |
| − | Growth of Caulobacter displaying cellulases on cellobiose and cellulose as sole carbon sources
| |
| − | </h3>
| |
| − | <h2 class="page-header">Results</h2>
| |
| − | <h2 class="page-header">References</h2>
| |
| − |
| |
| − | </div>
| |
| − |
| |
| − |
| |
| − | </body>
| |
| − | </html>
| |
