Difference between revisions of "Team:NYMU-Taipei/Project-Experiment"

Line 31: Line 31:
  
 
<p>
 
<p>
−
1) <b><i>Mcl1</i> promoter</b>
 
  
−
The <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAA<font color="black" style="text-decoration:underline;">GCGGCCGC</font>CATGATGGTCTAGGGAACG )
 
  
 +
1) Antibiotics
  
  
  
 +
2) hemolymph
  
−
2) KR
 
−
3) Antibiotics
 
−
4) hemolymph
 
  
  
  
 +
3) <b><i>Mcl1</i> promoter</b>
  
 +
    We designed the primers PMcl1-f(ACGTC//CTGCAG//AATCATGCAGCGCTATGAG, with a PstI site underlined) and PMcl1-r(ATAA//GCGGCCGC//CATGATGGTCTAGGGAACG with a NotI site underlined), according to the PMcl1 sequence<sup>[1]</sup>, to amplify the <i>Mcl1</i> promoter region with <i>Mcl1</i> mRNA 5'-untranslated region at the 5' end of the coding region. The whole length is 2772bp.
  
 +
    The gel image below shows that we succeed extracting the <i>Mcl1</i> promoter and its 5'-untranslated region (99bp downstream the promoter) from the genomic DNA of our chassis organism <i>M. anisopliae</i> ARSEF549.
  
 +
 +
<image: Pmcl1 PCR>
 +
 +
    Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one unknown PstI cut site inside the PMcl1 region.
 +
 +
<image PMcl1 digest>
 +
 +
    We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction.
 +
 +
 +
 +
4) <b>KillerRed expression in <i>M.anisopliae</i></b>
 +
 +
    We constructed a KillerRed expression cassette with a fungal promoter <i>PgpdA</i> and a fungal terminator <i>TtrpC</i>. This cassette was used to confirm that KillerRed can be expressed in <i>M.anisopliae</i>
 +
<image: circuit of P+K+T>
 +
 +
 +
    *The following fluorescence images indicated that KillerRed was successfully expressed in <i>M.anisopliae</i>.
 +
 +
<https://static.igem.org/mediawiki/parts/0/0f/PKT_FL.jpeg>
 +
 +
 +
 +
 +
 +
 +
 +
References:
 +
[1]
  
  
−
end
 
 
</p>
 
</p>
  

Revision as of 09:46, 19 October 2016

1) Antibiotics 2) hemolymph 3) Mcl1 promoter We designed the primers PMcl1-f(ACGTC//CTGCAG//AATCATGCAGCGCTATGAG, with a PstI site underlined) and PMcl1-r(ATAA//GCGGCCGC//CATGATGGTCTAGGGAACG with a NotI site underlined), according to the PMcl1 sequence[1], to amplify the Mcl1 promoter region with Mcl1 mRNA 5'-untranslated region at the 5' end of the coding region. The whole length is 2772bp. The gel image below shows that we succeed extracting the Mcl1 promoter and its 5'-untranslated region (99bp downstream the promoter) from the genomic DNA of our chassis organism M. anisopliae ARSEF549. Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one unknown PstI cut site inside the PMcl1 region. We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction. 4) KillerRed expression in M.anisopliae We constructed a KillerRed expression cassette with a fungal promoter PgpdA and a fungal terminator TtrpC. This cassette was used to confirm that KillerRed can be expressed in M.anisopliae *The following fluorescence images indicated that KillerRed was successfully expressed in M.anisopliae. References: [1]