Difference between revisions of "Team:NKU China/Notebook"

Latest revision as of 16:17, 19 October 2016

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-*C2-luxS* into GR286)

Laboratory Notes

☞☟ Week1 (May 16–May 22)

begin
➀
➁
➂

In order to make sure the efficiency of our "consumer", we should first knock out the luxS gene in our engineering bacteria GR286(a simplified strain of Bacillus amyloliquefaciens LL3). We used a markerless gene replacement method to knock out the luxS gene.

Construction of targeting vector : the upstream and downstream of luxS gene were combined by over-lapping PCR and ligated into plasmid pKSU.

pKSU-ΔluxS was transformed into GR286, and positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
pKSU-F	1μL
pKSU-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

The transformants were cultured at 42^oC with chloramphenicol to select single-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1-4 are single-crossover strains,
No.5 is positive control.)

☞☟ Week2 (May 23–May 29)

➀
➁

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn't get the double-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of double-crossover clones by PCR
(No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)

☞☟ Week3 (May 30–Jun 05)

➀
➁
➂

Transformants were cultured at 42^oC with chloramphenicol again and the single-crossover clones were selected successfully.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1&2&4 are single-crossover strains,No.5 is positive control. )

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain—GR286ΔluxS.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of Δ*luxS* clones by PCR
(The No.4 is the aimed strain&horbar;GR286Δ*luxS*)

☞☟ Week4 (Jun 06–Jun 12)

➀
➁
➂
➃
➄
➅

The GR286ΔluxS strain was cultured and made competent for future use.

The lsrACDB gene from Bacillus thuringiensis was cloned and ligated to T-vector.

50μL PCR system ×2
2× Taq Master Mix	25μL
lsrACDB-F	2μL
lsrACDB-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
57^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

The T-lsrACDB was transformed into DH5α and plate was coated, and then positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
M13F	1μL
M13R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(No. 3&4 are positive results)

After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are *lsrACDB* fragement, No.2 are linearized T-vector.)

The gene cloning process was repeated but there were still some mutations.

We finally decided to request the gene company to synthesize the lsrACDB gene.

☞☟ Week5 (Jun 13–Jun 19)

begin
➀
➁
➂
➃

This week, we started to construct another controller―supplier.

A strong promoter C2 was cloned from former kit and luxS gene was cloned from GR286.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
2× Taq Master Mix	25μL
luxS-F	2μL
luxS-R	2μL
Bacterium solution	1μL
GR286	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*
(NO.1&2 are C2, No.3&4 are *luxS*)

Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5α.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
luxS-R	2μL
C2	2μL
luxS	2μL
ddH2O	17μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
M13-F	1μL
M13-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized T-vector, No.2 are *C2-luxS* fragment.)

☞☟ Week6 (Jun 20–Jun 26)

➀
➁
➂
➃
➄

The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-C2-luxS from DH5α. Then the fragment C2-luxS was obtained by digestion and gel extraction.

40μL digestion system
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
T-C2-luxS	25μL
ddH2O	9μL
Total	20μL
Reaction condition: 37^oC for 40 min

The C2-luxS fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5α.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	5μL
ddH2O	11μL
Total	20μL
Reaction condition: 16^oC overnight

The plasmid pWH-C2-luxS was extracted from DH5α. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

The plasmid pWH-C2-luxS was extracted from JM110,and then it was treated with BamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation.[Failed]

☞☟ Week7 (Jun 27–Jul 03)

➀
➁
➂

This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.

We considered whether the luxS gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.

The plasmid pWH1520 contains a strong xylA promoter originating from Bacillus megaterium, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.

☞☟ Week8 (Jul 04–Jul 10)

➀
➁
➂
➃

luxS gene was cloned from GR286 using our new primers.

50μL PCR system ×2
2× Taq Master Mix	25μL
YD-luxS-F	2μL
YD-luxS-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

The luxS fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5α.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
pWH1520	25μL
ddH2O	9μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
pWH-F	1μL
pWH-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by colony PCR

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
pWH-luxs	10μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pWH1520, No.2 are *luxS* fragments.)

☞☟ Week9 (Jul 11–Jul 17)

➀
➁
➂
end

The sequencing result showed there's three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-luxS plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

the plasmid pWH-luxS was extracted from JM110,and it was treated withBamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation, and positive clones were selected.

The construction of supplier was accomplished!

☞☟ Week10 (Jul 18–Jul 24)

➀
➁

We have received the product of synthetic lsrACDB gene. We first used restriction-ligation method to ligate lsrACDB to plasmid pWH1520, but we failed to select positive after several tries.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Considering that the lsrACDB gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The lsrACDB sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5α. After that, verification PCR was used to select the positive clones. However, we didn't get a good result.

Selection of positive clones by colony PCR
(No.6 is positive control, No.1-5 are experimental groups)

☞☟ Week11 (Jul 25–Jul 31)

➀

We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our lsrACDB gene. It's encouraging that we succeeded to ligate the lsrACDB gene to the plasmid pHT-01.

Selection of positive clones by colony PCR
(No.3-6 are positive clones)

Restriction enzyme digestion verification
(No.2&3 are positive results.)

☞☟ Week12 (Aug 1–Aug 7)

➀
➁

Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

OD₆₀₀ of different groups at specific times

Growth curve of pWH-*luxS*, pWH-*luxS* + xyl and pWH1520

Growth curve of pHT-*lsrACDB* and pHT-01

Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Fluorescence intensity of different groups at specific times

Relative fluorescence intensity of different groups

☞☟ Week13 (Aug 8–Aug 14)

➀
➁

For our consumer, we should also overexpress the lsrK and lsrFG gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.

Restriction enzyme digestion verification
(No.1&3&4 are positive results. )

We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)

Fluorescence intensity of BB170 and co-culture medium

☞☟ Week14 (Aug 15–Aug 21)

begin
outline
1.1
1.2
1.3

Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with Escherichia coli whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.

The strains to be constructed are shown in the tables below.

AI-2 supplier
	LuxS	Mtn
pTrcHisB	Native	Native
pLuxS	Induced	Native
pLuxS-Mtn	Induced	Induced

AI-2 consumer
	LsrACDB	LsrK	LsrFG
pTrcHisB	Native	Native	Native
pLsrACDB	Induced	Native	Native
pLsrFG	Native	Native	Induced
pLsrK	Native	Induced	Native
pLsrACDBFG	Induced	Native	Induced
pLsrACDBK	Induced	Constitutive	Native
plsrACDBFGK	Induced	Constitutive	Induced

The sequences of lsrACDB, lsrFG, lsrK, luxS, mtn gene in E.coli K12 were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.

Primers used in the construction of AI-2 controller
Primer name	Sequence
lsrACDBFG1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDBFG1-R	TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC
lsrACDBFG2-F	TGTTTGGCGTTTCCGCGATTG
lsrACDBFG2-R	GCACTCTCACACCACGTTGCATGGCGCGTTTC
lsrACDBFG3-F	GTGGTGTGAGAGTGCTGAC
lsrACDBFG3-R	ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC
lsrACDB1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDB1-R	ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC
lsrACDB2-F	CTCGGCGGTTCCGGTGCGAT
lsrACDB2-R	ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG
luxS-F	ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC
luxS-R	GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC
mtn-F	TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC
mtn-R	TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG
luxS-Fd	GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC
luxS-Rv	GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG
lsrK-Fd	GGGGTACCCCATGGCTCGACTCTTTACC
lsrK-Rv	GGAATTCCCTATAACCCAGGCGCTTTCC
lsrFG-Fd	CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG
lsrFG-Rv	GAAGATCTTCTCACGGCATCAACCCATTGAAC
lsrK-F	AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC
lsrK-R	TTCGAACTATAACCCAGGCGCTTTCC
BK-JC-F	TTTCAGTGTATGTCGCGGATGC
GK-JC-F	TTGCGCTTCGATGTCTTACAGG
pTrc-JC-F	TGGGCACTCGACCGGAATTATC
pTrc-JC-R	GCTACTGCCGCCAGGCAAATTC

Construction of pLuxS-Mtn

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-F	2μL
luxS-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
mtn-F	2μL
mtn-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30sec	30 cycles
72^oC	45 sec
72^oC	10 min
16^oC	∞

ClonExpress technique was used to ligate luxS and mtn genes to plasmid pTrcHisB. The recombinant vector pTrc-luxS-mtn was transformed into E.coli K12. After that, verification PCR was performed to select the positive clones.

20μL PCR system
PrimeSTAR Max Premix(2×)	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3&5&8 are positive results)

3 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Sac Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-luxS-mtn	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pTrcHisB, No.2 are *luxS*-*mtn* fragment. )

☞☟ Week15 (Aug 22–Aug 28)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
3.1
3.2
3.3

Construction of pLuxS
Construction of pLsrACDB
Construction of pLsrACDBFG

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-Fd	2μL
luxS-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

The luxS gene was purified by gel extraction. Then, both the luxS segment and pTrcHisB vector were treated with restriction enzyme. After that, luxS gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
luxS	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	50 sec
72^oC	10 min
16^oC	∞

One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-luxS	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 is linearized pTrcHisB + *luxS*, No.2 is plasmid pTrc-*luxS*. )

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB1-F	2μL
lsrACDB1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB2-F	2μL
lsrACDB2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	2 min 20 sec
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDB1*,*lsrACDB1*2

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG1-F	2μL
lsrACDBFG1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG2-F	2μL
lsrACDBFG2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG3-F	2μL
lsrACDBFG3-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDBFG*1,*lsrACDBFG*2, *lsrACDBFG*3

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1-4 are linearized pTrcHisB + *lsrACDBFG*, No.5 is plasmid pTrc-*lsrACDBFG*.)

☞☟ Week16 (Aug 29–Sep 04)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
2.4
3.1
3.2
3.3
3.4

Construction of pLsrFG
Construction of pLsrACDBK
Construction of pLsrACDBFGK

lsrFG gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrFG-Fd	2μL
lsrFG-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 15 sec
72^oC	10 min
16^oC	∞

The lsrFG gene was purified by gel extraction. Then, both the lsrFG segment and pTrcHisB vector were treated with restriction enzyme. After that, lsrFG gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
lsrFG	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
luxSFG	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO. 1&3 are positive results)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-lsrFG	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDB vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDB	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
BK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDBFG	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDFGB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
GK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3 is positive result)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBKFGK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week17 (Sep 05–Sep 11)

outline
1.1
1.2
1.3
1.4

Construction of pLsrK

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-Fd	2μL
lsrK-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-HisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-lsrK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week18 (Seq 12–Seq 18)

➀
➁

We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.

Relative expression of several overexpressed genes at the mRNA level

SDS-PAGE was performed to detect the expression of these genes at the protein level.

pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE

☞☟ Week19 (Seq 19–Seq 25)

➀
➁

Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Relative fluorescence intensity of suppliers at specific times

Relative fluorescence intensity of consumers at specific times

HPLC was performed to detect the production of AI-2 of the strain pLuxS.

HPLC result of AI-2 production of luxS overexpression strain and negative control

☞☟ Week20 (Seq 26–Oct 02)

➀
➁

Biofilm studies and evaluation:
pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 ^oC in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 ^oC with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.

Relative biofilm production of suppliers

Relative biofilm production of consumers

Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.

@@ Line 1: / Line 1: @@
-{{NKU_China/wiki}}
+{{NKU_China/menubar}}
 <html>
 <head>
-     <!--delete in wiki-->
-     <meta name="viewport" content="width=device-width, initial-scale=1">
+     <!--separatrix-->
-    <link rel="stylesheet" href="https://2016.igem.org/Template:NKU_China/css/jquery-ui?action=raw&ctype=text/css" />
+     <style>
-    <script src="https://2016.igem.org/Template:NKU_China/js/jquery?action=raw&ctype=text/javascript"></script>
+        .main#notebook {
-    <script src="https://2016.igem.org/Template:NKU_China/js/jquery-ui?action=raw&ctype=text/javascript"></script>
+            padding: 0 8vw;
-    <link rel="stylesheet" href="https://2016.igem.org/Template:NKU_China/css/share?action=raw&ctype=text/css">
+        }
+        #notebook .ui-accordion .ui-accordion-content {
+            height: calc(100vh - 13rem - 18px);
+            position: relative;
+            z-index: 3;
+            box-sizing: border-box;
+            background-color: transparent;
+        }
-    <link rel="stylesheet" href="share.css">
+         #notebook .ui-tabs {
-    <style>
+             margin: 0.2rem;
-        /**/
+             background-color: transparent;
-         #group-wrapper {
-             text-align:center;
-            display:flex;
-             min-height:54vw;
          }
-         #group-wrapper img {
+         #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor {
-             border-radius: 3vw;
+             font-weight:normal;
-            width:96vw;
-            height:54vw;
          }
-         #group-wrapper:hover img{
+         #week16 .ui-tabs-anchor {
-             display:none;
+             font-size:1.2rem;
          }
-         #group-wrapper article {
+         #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor.circle-number {
-             margin:auto;
+             font-weight:bold;
-            padding:0;
-            width:84%;
-            display:none;
-            overflow:auto;
          }
-         #group-wrapper:hover article {
+         #notebook .ui-tabs .ui-tabs-panel {
-             display:block;
+             position: relative;
+            z-index: 0;
+            background-color: transparent;
+            height: calc(100vh - 17rem - 18px);
+            overflow: auto;
          }
-         @media all and (max-width: 1025px) {
+         #notebook .ui-tabs-panel > .p, #notebook .ui-tabs-panel > ol, #notebook .ui-tabs-panel > ul {
-            #group-wrapper {
+            margin: 0.8rem 1.6rem;
-                display:block;
+        }
-            }
-            #group-wrapper:hover img{
+        #notebook .flex-container {
-                display:inline;
+            display: flex;
-             }
+             justify-content: space-around;
+            align-content: space-around;
+            flex-wrap: wrap;
+            background-color: transparent;
+        }
-            #group-wrapper article {
+        #notebook  .table-wrapper {
-                display:block;
+            margin: auto;
-             }
+             padding: 1rem;
+            position:relative;
          }
-        /**/
+         .table-wrapper div.rbrace {
-        #group-wrapper article .h1 {
+             font-weight:100;
-             font-size:3.8rem;
+             color:dodgerblue;
-             margin:1.2rem 0;
+            position:absolute;
+            right:6.5rem;
+            bottom:5rem;
+            font-size:4rem;
+            z-index:4;
          }
-         #group-wrapper article .p {
-            font-size:1.5rem;
+         #notebook  table {
-            line-height:1.4;
+             margin: 0;
-             margin:0.6rem 1.2rem;
          }
-         @media all and (max-width: 737px) {
+         #notebook table, #dongzhuoer td {
-             #group-wrapper article .h1 {
+             border: none;
-                font-size:1.5rem;
+        }
-            }
-            #group-wrapper article .p {
+        #notebook  table {
-                font-size:0.8rem;
+            font-size: 1rem;
-             }
+             padding: 0;
          }
-       @media all and (min-width: 737px) and (max-width: 1025px) {
+        #notebook  table caption {
-             #group-wrapper article .h1 {
+             border-top: 0.1rem solid;
-                font-size:2rem;
+            border-bottom: 0.1rem solid;
-                margin:0.6rem;
+            margin: 0;
-             }
+            padding: 0.2rem 0;
+             text-align: center;
+            background-color: white;
+        }
-             #group-wrapper article .p {
+        #notebook  table tr {
-                font-size:1.2rem;
+             margin: 0;
-                margin:0.6rem;
+            padding: 0;
-             }
+            background-color: white;
-         }
+        }
+        #notebook  table td {
+            border: none;
+            margin: 0;
+            padding: 0.2rem 1.2rem;
+        }
+        #notebook table tr:last-child td {
+            border-bottom: 0.1rem solid;
+        }
+        figure {
+            text-align: center;
+            font-size: 0.9rem;
+            margin: auto;
+            padding: 1rem;
+        }
+        figure img {
+            width: 100%;
+            margin-bottom:0.25rem;
+        }
+        figure img.white {
+             background-color:white;
+        }
+        figure figcaption {
+            text-align:center;
+            line-height:1.25;
+        }
+        #notebook figure figcaption .p {
+            text-indent:0;
+            text-align:center;
+        }
+        #notebook .ui-tabs-panel li {
+            margin:0.3rem;
+         }
      </style>
-     <style>
+     <style title="table-theme.css">
          /**/
-         @media all and (max-width: 800px) {
+         #notebook .table-theme-0 {
-             main {
+            /*color: rgb(49,132,155);*/
-                width:98vw;
+            background-color:transparent;
-             }
+            border-collapse:collapse;
+             /*color:blue;*/
          }
-        /**/
+         #notebook .table-theme-0 tr {
-         #accordion {
+             background-color:transparent;
-             margin-top:2rem;
          }
-         @media all and (max-width: 1025px) {
+         #notebook .table-theme-0 tr td {
-             #accordion {
+            background-color:transparent;
-                margin-top:1rem;
+             border:0.05rem solid white;
-             }
+            border-bottom-width:0.05rem;
          }
-         /**/
+         #notebook .table-theme-0 tr:last-child td {
-        .ui-accordion .ui-accordion-content {
+             border-bottom-width:0.05rem;
-             padding:0.6rem 1.2rem;
-            height:calc(100vh - 10rem - 18px);
-            box-sizing:border-box;
          }
-         .ui-tabs .ui-tabs-nav .ui-tabs-tab .ui-tabs-anchor {
+         #notebook .table-theme-0 caption {
-             font-size:1.2rem;
+             border:none;
-             padding:0.4rem 0.8rem;
+             background-color:transparent;
          }
-         .ui-tabs .ui-tabs-panel {
+         /*PCR system*/
-             text-align:center;
+        #notebook .table-theme-1 {
-            padding:1.2rem 2.4rem ;
+             color: rgb(49,132,155);
-            height:calc(100vh - 17rem - 18px);
-            display:flex;
          }
-         @media all and (max-width: 800px) {
+         #notebook .table-theme-1 caption {
-             .ui-accordion .ui-accordion-header {
+             border-top-color: rgb(75,172,198);
-                font-size:1rem;
+            border-bottom-color: rgb(75,172,198);
-                padding:0.2rem;
+        }
-            }
-            .ui-accordion .ui-accordion-content {
+        #notebook .table-theme-1 table tr:last-child td {
-                padding:0.2rem 0.4rem;
+            border-bottom-color: rgb(75,172,198);
-                height:calc(100vh - 8rem - 18px);
+        }
-            }
-            .ui-tabs .ui-tabs-nav .ui-tabs-tab .ui-tabs-anchor {
+        #notebook .table-theme-1 tr:nth-child(odd) {
-                font-size:0.6rem;
+            background-color: rgb(210,234,241);
-                padding:0.2rem;
+        }
-            }
-            .ui-tabs .ui-tabs-panel {
+        /*PCR reaction condition*/
-                padding:0.4rem 0.8rem ;
+        #notebook .table-theme-2 {
-                height:calc(100vh - 12rem - 18px);
+            color: rgb(118,146,60);
-             }
+             position:relative;
          }
-         @media all and (min-width: 801px) and (max-width: 1025px)  {
+         #notebook .table-theme-2 caption {
-             .ui-tabs .ui-tabs-nav .ui-tabs-tab .ui-tabs-anchor {
+             border-top-color: rgb(155, 187, 89);
-                font-size:0.9rem;
+            border-bottom-color: rgb(155, 187, 89);
-                padding:0.4rem;
-            }
          }
-         /**/
+         #notebook .table-theme-2 table tr:last-child td {
-        .ui-tabs-panel img{
+             border-bottom-color: rgb(75,172,198);
-             display:block;
-            margin:auto;
-            padding:0;
-            height:100%;
-            width:auto;
          }
-         @media all and (orientation: portrait ) {
+         #notebook .table-theme-2 tr:nth-child(odd) {
-             .ui-tabs-panel img {
+             background-color: rgb(230,238,213);
-                height:auto;
-                width:100%;
-            }
          }
-         .ui-tabs-panel:hover img {
+         /*ligation system*/
-             display:none;
+        #notebook .table-theme-3 {
+             color: rgb(95, 73, 122);
          }
-         /**/
+         #notebook .table-theme-3 caption {
-        .ui-tabs-panel article {
+             border-top-color: rgb(128, 100, 162);
-             display: none;
+             border-bottom-color: rgb(128, 100, 162);
-             margin:auto;
          }
-         .ui-tabs-panel:hover article {
+         #notebook .table-theme-3 table tr:last-child td {
-             display: block;
+             border-bottom-color: rgb(128, 100, 162);
          }
-         .ui-tabs-panel .h3 {
+         #notebook .table-theme-3 tr:nth-child(odd) {
-             font-size:2rem;
+             background-color: rgb(223, 215, 232);
-            margin:0.8rem 0;
          }
-        .ui-tabs-panel .h4 {
-            font-size:1.4rem;
-            margin:0.6rem 0;
-        }
-         .ui-tabs-panel .p {
+         /*digestion system*/
-             font-size:1.2rem;
+        #notebook .table-theme-4 {
-            line-height:1.4;
+             color: rgb(148, 54, 52);
-            margin:0.4rem;
+         }
-         }
-         @media all and (max-width: 737px) {
+         #notebook .table-theme-4 caption {
-           .ui-tabs-panel .h3 {
+            border-top-color: rgb(192, 80, 77);
-                font-size:1.2rem;
+            border-bottom-color: rgb(192, 80, 77);
-                margin:0.4rem;
+        }
-            }
-            .ui-tabs-panel .h4 {
+        #notebook .table-theme-4 table tr:last-child td {
-                font-size:1rem;
+            border-bottom-color: rgb(192, 80, 77);
-                margin:0.4rem;
+        }
-            }
-            .ui-tabs-panel .p {
+        #notebook .table-theme-4 tr:nth-child(odd) {
-                font-size:0.8rem;
+            background-color: rgb(239, 211, 210);
-                line-height:1.3;
+        }
-                margin:0.2rem;
-            }
-         }
+         /*methylation  system*/
+         #notebook .table-theme-5 {
-        @media all and (min-width: 737px) and (max-width: 1025px) {
+             color: rgb(227, 108, 10);
-             .ui-tabs-panel .h3 {
+        }
-                font-size:2rem;
-                margin:0.4rem;
-            }
-            .ui-tabs-panel .h4 {
+        #notebook .table-theme-5 caption {
-                margin:0.4rem;
+            border-top-color: rgb(247, 150, 70);
-             }
+             border-bottom-color: rgb(247, 150, 70);
+        }
-            .ui-tabs-panel .p {
+        #notebook .table-theme-5 table tr:last-child td {
-                font-size:1.1rem;
+            border-bottom-color: rgb(247, 150, 70);
-            }
+         }
-         }
+        #notebook .table-theme-5 tr:nth-child(odd) {
+            background-color: rgb(253, 228, 208);
+        }
+        /*Groups divided*/
+        #notebook .table-theme-6 {
+            color: rgb(0, 0, 0);
+        }
+        #notebook .table-theme-6 caption {
+            border-top-color: rgb(0, 0, 0);
+            border-bottom-color: rgb(0, 0, 0);
+        }
+        #notebook .table-theme-6 table tr:last-child td {
+            border-bottom-color: rgb(0, 0, 0);
+        }
+        #notebook .table-theme-6 tr:nth-child(odd) {
+            background-color: rgb(192, 192, 192);
+        }
      </style>
-     <script id="ready-js">
+     <script title="ready-js">
          $(function () {
+            adjust_figure(1.2);
              $("#accordion").accordion({
                  header: ".accordion-header",
@@ Line 245: / Line 285: @@
                  heightStyle: 'content',
                  collapsible: true,
-                 active:2,
+                 active: 18,
                  icons: false,
              });
@@ Line 254: / Line 294: @@
                          event: "mouseover",
                          heightStyle: 'content',
-                         active: 1,
+                         active:2,
                      });
                  }
-             );
+             )
-         })
+            $('#particles-js').hide();
+         });
      </script>
 </head>
-<body>
+<body id="dongzhuoer">
+     <div style="display:none">
+        <table class="table-theme-1" id="50&mu;L PCR system &times;2">
+            <caption>50&mu;L PCR system &times;2</caption>
+            <tr>
+                <td>2&times; Taq Master Mix</td>
+                <td>25&mu;L</td>
+            </tr>
+            <tr>
+                <td>C2-F</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>C2-R</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>p-C2</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>19&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>50&mu;L</td>
+            </tr>
+        </table>
+        <table class="table-theme-2" id="PCR reaction condition">
+            <caption>PCR reaction condition</caption>
+            <tr>
+                <td>94<sup>o</sup>C</td>
+                <td>10 min</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>94<sup>o</sup>C</td>
+                <td>30 sec</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>58<sup>o</sup>C</td>
+                <td>15 sec</td>
+                <td>30 cycles</td>
+            </tr>
+            <tr>
+                <td>72<sup>o</sup>C</td>
+                <td>30 sec</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>72<sup>o</sup>C</td>
+                <td>10 min</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>16<sup>o</sup>C</td>
+                <td>&infin;</td>
+                <td></td>
+            </tr>
+        </table>
+        <table class="table-theme-3" id="20&mu;L ligation system">
+            <caption>20&mu;L ligation system</caption>
+            <tr>
+                <td>10&times; DNA Ligase Buffer</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>T4 DNA Ligase</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>pMD19 T-Simple Vector</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td><i>C2-luxS</i></td>
+                <td>4&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>12&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>20&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+            </tr>
+        </table>
+        <table class="table-theme-4" id="20&mu;L digestion  system">
+            <caption>20&mu;L digestion  system</caption>
+            <tr>
+                <td>10&times; FastDigest Buffer</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>BamH &#8544;</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>T-<i>lsrACDB</i></td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>7&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>20&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+            </tr>
+        </table>
+        <table class="table-theme-5" id="100&mu;L methylation  system">
+            <caption>100&mu;L methylation  system</caption>
+            <tr>
+                <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                <td>10&mu;L</td>
+            </tr>
+            <tr>
+                <td>BamH &#8544; methyltransferase</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>S-adenosylmethionine</td>
+                <td>0.5&mu;L</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>C2-luxS</i></td>
+                <td>80&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>8.5&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>100&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+            </tr>
+        </table>
+        <table class="table-theme-6" id="Groups divided in this experiment">
+            <caption>Groups divided in this experiment</caption>
+            <tr>
+                <td>GR286</td>
+                <td>wild strain as control group</td>
+            </tr>
+            <tr>
+                <td>GR286&Delta;<i>luxS</i></td>
+                <td>GR286 without <i>luxS</i> gene</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>luxS</i></td>
+                <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>luxS</i> &plus; xyl</td>
+                <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
+            </tr>
+            <tr>
+                <td>pWH1520</td>
+                <td>empty plasmid in GR286 as control group</td>
+            </tr>
+            <tr>
+                <td>pHT-<i>lsrACDB</i></td>
+                <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
+            </tr>
+            <tr>
+                <td>pHT-01</td>
+                <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
+            </tr>
+        </table>
+        <figure>
+            <img src="image/Notebook/notebook-6-13-1.png" width="347" height="284">
+            <figcaption>
+                <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
+            </figcaption>
+        </figure>
      </div>
-        <div id="group-wrapper">
+    <div id="particles-js"></div>
-            <img src="https://static.igem.org/mediawiki/2016/4/4b/T--NKU_China--whole-group-1366.jpg"/>
+    <script src="https://2016.igem.org/Template:NKU_China/js/particlesJS?action=raw&ctype=text/javascript"></script>
-            <article>
+    <div class="main" id="notebook">
-                <div class="h1">Welcome to Our Awesome Team!</div>
+        <div class="h1">Laboratory Notes</div>
-                    <div class="p">
+         <div id="accordion">
-                        NKU_China consists of faculty members and students from Nankai University, Tianjin. Located in the east coast of Asia and one of the most developed and prosperous cities in mainland China, Nankai University is making groundbreaking progress in both natural and social sciences while holding fast to the orthodox beliefs that inspire us to dedicate to the interest of the public and the nation.
+            <div class="accordion-fragment" id="week1">
-                    </div>
+                <div class="accordion-header">
-                    <div class="p">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week1 (May 16&ndash;May 22)
-undergraduate students from College of Life Science consist of the absolute main force of Team NKU_China. Sharing "iGEMer" as our common title, the team members work closely together from brainstorming solutions for experimental problems to discussing the future prospect of synthetic biology with great enthusiasm and creation. In the meantime, we frequently adjust the project design and experiment plans under the advice and instructions of three experienced graduate instructors and three distinguished PIs.
+                </div>
-                    </div>
+                <div class="accordion-content">
-                    <div class="p">
+                    <div class="tabs" id="tabs1">
-                        All of the team members are looking forward to presenting our project and sharing the story of the great science adventure of Team NKU_China to iGEMers all over the globe at Giant Jamboree. Do meet us at our presentation and poster stand!
+                        <ul>
-                    </div>
+                            <li><a href="#fragment1-1">begin</a></li>
-            </article>
+                            <li><a class="circle-number" href="#fragment1-2">&#10112;</a></li>
-         </div>
+                            <li><a class="circle-number" href="#fragment1-3">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment1-4">&#10114;</a></li>
-        <main>
+                        </ul>
-            <div id="accordion">
+                        <div id="fragment1-1">
-                <div class="accordion-fragment">
+                            <div class="p">
-                    <div class="accordion-header">
+                                In order to make sure the efficiency of our "consumer", we should first knock out the <i>luxS</i> gene in our engineering bacteria GR286(a simplified strain of <i>Bacillus amyloliquefaciens</i> LL3). We used a markerless gene replacement method to knock out the <i>luxS</i> gene.
-                        <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;PI
-                    </div>
-                    <div class="accordion-content">
-                        <div class="tabs" id="PI-tabs">
-                            <ul>
-                                <li><a href="#fragment1-1">Cunjiang Song</a></li>
-                                <li><a href="#fragment1-2">Fuchen Shi</a></li>
-                                <li><a href="#fragment1-3">Mingqiag Qiao</a></li>
-                             </ul>
-                            <div id="fragment1-1">
-                                <img src="https://static.igem.org/mediawiki/2016/f/f0/T--NKU_China--songcunjiang-1366.jpg">
-                                <article class="personal-description">
-                                    <div class="h3">Cunjiang Song</div>
-                                        <div class="p">
-                                            Prof. Cunjiang Song got B.S. Degree in 1983, from the Department of Biology, Northwest University in China, majoring in Microbiology. His Doctor of Engineering Degree was obtained in 2002, from the Graduate School of Science and Engineering, Toyama University, Japan, majoring in Life and Environmental Sciences.
-                                        </div>
-                                        <div class="p">
-                                            He established the Environmental Microbiology and Microbial Synthesis Laboratory in the College of Life Sciences, Nankai University. More than 80 papers were published in academic journals such as Scientific Reports, Metabolic Engineering, Applied Microl. Biotech., etc. 15 patents were granted.
-                                        </div>
-                                        <div class="p">
-                                            He is now a director of Chinese Society of Microbiology, as well as the general director of Tianjin Society of Microbiology.
-                                        </div>
-                                </article>
                              </div>
-                            <div id="fragment1-2">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/1/1f/T--NKU_China--shifuchen-1366.jpg">
+                        <div id="fragment1-2">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Fuchen Shi</div>
+                                Construction of targeting vector : the upstream and downstream of <i>luxS</i> gene were combined by over-lapping PCR and ligated into plasmid pKSU.
-                                        <div class="p">
-                                            Professor Fuchen Shi is the primary PI of iGEM 2016 Team NKU_China. Prof. Shi is Ph.D. supervisor and the dean of Department of Botany and Ecology, College of Life Science, Nankai University. He got his Master degree in botany at Northeast Forestry University in 1989 and stayed there as a faculty member thereafter. In 1997, he got his Ph.D. degree in agronomy at Graduate School of agricultural and Life Sciences, University of Tokyo, Japan. In 2001, he accomplished his research as a special researcher at Forestry and Forest Products Research Institute, Ministry of Agriculture, Forestry and Fisheries of Japan and left the Postdoctoral Station in Forestry of Northeast Forestry University. Prof. Shi has successively held the position of Lecturer, Associate Professor, Professor, Ph.D. Supervisor of Northeast Forestry University, Researcher, Ph.D. Supervisor at Knowledge Innovation Base of Institute of Geographic Sciences and Natural Resources, Chinese Academy of Sciences. Prof. Shi also once held the position of Special Professor in Natural and Environmental Sciences of Graduate Schools of Frontier Sciences, University of Tokyo, Special Professor of Graduate School of Agricultural and Life Sciences, University of Tokyo. Prof. Shi has published around 150 articles and more than 10 volumes of literature in environmental botany, plant resources and plant synecology.
-                                        </div>
-                                </article>
                              </div>
-                            <div id="fragment1-3">
+                        </div>
-                                 <img src="https://static.igem.org/mediawiki/2016/1/10/T--NKU_China--qiaomingqiang-4-3-1366.jpg">
+                        <div id="fragment1-3">
-                                 <article class="personal-description">
+                            <div class="p">
-                                     <div class="h3">Mingqiag Qiao</div>
+                                 pKSU-&Delta;<i>luxS</i> was transformed into GR286, and positive clones were selected.
+                            </div>
-                                         <div class="p">
+                            <div class="flex-container">
+                                <div class="table-wrapper">
-                                         </div>
+                                    <table class="table-theme-1" id="table1-2-1">
+                                        <caption>20&mu;L PCR system</caption>
-                                 </article>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pKSU-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pKSU-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table1-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e9/T--NKU_China--notebook-1-5-1.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment1-4">
+                            <div class="p">
+                                The transformants were cultured at 42<sup>o</sup>C with chloramphenicol to select single-crossover clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table1-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                     <div class="rbrace">&#125;</div>
+                                     <table class="table-theme-2" id="table1-3-2">
+                                         <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/de/T--NKU_China--notebook-1-5-2.jpeg">
+                                    <figcaption>
+                                         <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
+                                        (No.1-4 are single-crossover strains, <br>No.5 is positive control.)
+                                    </figcaption>
+                                 </figure>
                              </div>
                          </div>
                      </div>
                  </div>
-                <div class="accordion-fragment">
+            </div>
-                    <div class="accordion-header">
+            <div class="accordion-fragment" id="week2">
-                        <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Instructor
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week2 (May 23&ndash;May 29)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs2">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment2-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment2-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment2-1">
+                            <div class="p">
+                                The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
+                            </div>
+                        </div>
+                        <div id="fragment2-2">
+                            <div class="p">
+                                The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn&#39;t get the double-crossover clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table2-2-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table2-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3d/T--NKU_China--notebook-1-5-3.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of double-crossover clones by PCR</span></div>
+                                        (No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
                      </div>
-                     <div class="accordion-content">
+                </div>
-                        <div class="tabs" id="instructor-tabs">
+            </div>
-                            <ul>
+            <div class="accordion-fragment" id="week3">
-                                <li><a href="#fragment2-1">Haosheng Shen</a></li>
+                <div class="accordion-header">
-                                <li><a href="#fragment2-2">Yufen Quan</a></li>
+                     <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week3 (May 30&ndash;Jun 05)
-                                <li><a href="#fragment2-3">Yulei Dang</a></li>
+                </div>
-                            </ul>
+                <div class="accordion-content">
-                            <div id="fragment2-1">
+                    <div class="tabs" id="tabs3">
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                        <ul>
-                                <article class="personal-description">
+                            <li><a class="circle-number" href="#fragment3-1">&#10112;</a></li>
-                                    <div class="h3">Haosheng Shen</div>
+                            <li><a class="circle-number" href="#fragment3-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment3-3">&#10114;</a></li>
-                                        <div class="p">
+                        </ul>
+                        <div id="fragment3-1">
-                                        </div>
+                            <div class="p">
+                                Transformants were cultured at 42<sup>o</sup>C with chloramphenicol again and the single-crossover clones were selected successfully.
-                                </article>
                              </div>
-                             <div id="fragment2-2">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                <div class="table-wrapper">
-                                <article class="personal-description">
+                                    <table class="table-theme-1" id="table3-1-1">
-                                    <div class="h3">Yufen Quan</div>
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
-                                        <div class="p">
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
-                                         </div>
+                                        </tr>
+                                        <tr>
-                                 </article>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table3-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/93/T--NKU_China--notebook-1-5-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
+                                         (No.1&amp;2&amp;4 are single-crossover strains,No.5 is positive control. )
+                                    </figcaption>
+                                 </figure>
                              </div>
-                             <div id="fragment2-3">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                        <div id="fragment3-2">
-                                 <article class="personal-description">
+                             <div class="p">
-                                     <div class="h3">YULEI DANG</div>
+                                The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
+                            </div>
-                                         <div class="p">
+                        </div>
+                        <div id="fragment3-3">
-                                         </div>
+                            <div class="p">
+                                The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain&#8212;GR286&Delta;<i>luxS</i>.
-                                 </article>
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table3-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                     <div class="rbrace">&#125;</div>
+                                     <table class="table-theme-2" id="table3-3-2">
+                                         <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-1-5-5.png">
+                                    <figcaption>
+                                         <div class="p"><span>Selection of &Delta;<i>luxS</i> clones by PCR</span></div>
+                                        (The No.4 is the aimed strain&horbar;GR286&Delta;<i>luxS</i>)
+                                     </figcaption>
+                                 </figure>
                              </div>
                          </div>
                      </div>
                  </div>
-                <div class="accordion-fragment">
+            </div>
-                    <div class="accordion-header">
+            <div class="accordion-fragment" id="week4">
-                        <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Member&#10112;
+                <div class="accordion-header">
-                    </div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week4 (Jun 06&ndash;Jun 12)
-                    <div class="accordion-content">
+                </div>
-                        <div class="tabs" id="member1-tabs">
+                <div class="accordion-content">
-                            <ul>
+                    <div class="tabs" id="tabs4">
-                                <li><a href="#fragment3-1">Yibing Wei</a></li>
+                        <ul>
-                                <li><a href="#fragment3-2">Yujie Zhao</a></li>
+                            <li><a class="circle-number" href="#fragment4-1">&#10112;</a></li>
-                                <li><a href="#fragment3-3">Fankang Meng</a></li>
+                            <li><a class="circle-number" href="#fragment4-2">&#10113;</a></li>
-                                <li><a href="#fragment3-4">Xiao Liu</a></li>
+                            <li><a class="circle-number" href="#fragment4-3">&#10114;</a></li>
-                                <li><a href="#fragment3-5">Zhaoran Zhang</a></li>
+                            <li><a class="circle-number" href="#fragment4-4">&#10115;</a></li>
-                                <li><a href="#fragment3-6">Xinyu Ma</a></li>
+                            <li><a class="circle-number" href="#fragment4-5">&#10116;</a></li>
-                                <li><a href="#fragment3-7">Hanchenxi Zhang</a></li>
+                            <li><a class="circle-number" href="#fragment4-6">&#10117;</a></li>
-                            </ul>
+                        </ul>
-                            <div id="fragment3-1">
+                        <div id="fragment4-1">
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                            <div class="p">
-                                <article class="personal-description">
+                                The GR286&Delta;<i>luxS</i> strain was cultured and made competent for future use.
-                                    <div class="h3">Yibing Wei</div>
-                                        <div class="p">
-                                            Hi, everyone! my name is Yujie Zhao, a member of laboratorial group in the iGEM NKU_China team. Besides, I&#39;m the leader of design group. In my leisure time, reading and drawing are my favorite things, because they can calm my mind. I also like challenging myself and mastering something new like making handcrafts, learning new experiment skills and subtitling movie. The word 'impossiblility' is not in my dictionary.
-                                        </div>
-                                </article>
                              </div>
-                            <div id="fragment3-2">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                        <div id="fragment4-2">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Yujie Zhao</div>
+                                The <i>lsrACDB</i> gene from <i>Bacillus thuringiensis</i> was cloned and ligated to T-vector.
-                                        <div class="p">
-                                        </div>
-                                </article>
                              </div>
-                             <div id="fragment3-3">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/44/T--NKU_China--mengfankang-1366.jpg">
+                                 <div class="table-wrapper">
-                                 <article class="personal-description">
+                                    <table class="table-theme-1" id="table4-2-1">
-                                     <div class="h3">Fankang Meng</div>
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
-                                         <div class="p">
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
-                                         </div>
+                                        </tr>
+                                        <tr>
-                                 </article>
+                                            <td><i>lsrACDB</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                     <div class="rbrace">&#125;</div>
+                                     <table class="table-theme-2" id="table4-2-2">
+                                         <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>57<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table4-2-3">
+                                         <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                     </table>
+                                 </div>
                              </div>
-                            <div id="fragment3-4">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/3/3a/T--NKU_China--liuxiao-4-3-1366.jpg">
+                        <div id="fragment4-3">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Xiao Liu</div>
+                                The T-<i>lsrACDB</i> was transformed into DH5&alpha; and plate was coated, and then positive clones were selected.
-                                        <div class="p">
-                                            Hello everyone! This is Xiao Liu. It's my second time attending iGEM. I've grown from a sophomore, who was unfimiliar with synthetic biology and science research, into a senior who is devoting myself to them. I was in charge of our wiki last time and our whole project this time. I should say that iGEM has influenced me a lot in many positive ways. I hope our project will attract you this time and  my work can contribute to synbio in the future.
-                                        </div>
-                                </article>
                              </div>
-                             <div id="fragment3-5">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                <div class="table-wrapper">
-                                <article class="personal-description">
+                                    <table class="table-theme-1" id="table4-3-1">
-                                    <div class="h3">Zhaoran Zhang</div>
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
-                                        <div class="p">
+                                            <td>2&times; Taq Master Mix</td>
-                                            I am an undergraduate student member of the experiment division of iGEM 2016 Team NKU_China I am a girl of various of interests and among them my favorites are music and travelling. I grew up in countryside and I liked to play around in the fields and observe all kinds of creatures especially plants. My love for botany built up in my childhood and now I have become an expert in plant taxonomy. It will be my lifelong career to explore the secret and beauty of life.
+                                            <td>10&mu;L</td>
-                                        </div>
+                                        </tr>
+                                        <tr>
-                                 </article>
+                                            <td>M13F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>M13R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table4-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>59<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/72/T--NKU_China--notebook-1-5-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (No. 3&amp;4 are positive results)
+                                    </figcaption>
+                                 </figure>
                              </div>
-                            <div id="fragment3-6">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/c/ca/T--NKU_China--maxinyu-1366.jpg">
+                        <div id="fragment4-4">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Xinyu Ma</div>
+                                After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.
-                                        <div class="p">
-                                            I am Ma Xinyu, a junior student of College of Life Science in Nankai University. I have been working on the study about molecular modification of microorganism for two years. It&#39;s my first time to attend the iGEM competition and I believe it will be a great challenge but also a chance for me. This year, I spend most of my time on the iGEM competition. I&#39;m generally responsible for the experimental part in our team. I will do my best to complete our research and cooperate with my team member to finish the competition perfectly. Looking forward for the final match in Boston!
-                                        </div>
-                                </article>
                              </div>
-                             <div id="fragment3-7">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                <div class="table-wrapper">
-                                <article class="personal-description">
+                                    <table class="table-theme-4" id="table4-4-1">
-                                    <div class="h3">Hanchenxi Zhang</div>
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
-                                     <div class="p">
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
-                                    </div>
+                                        </tr>
+                                        <tr>
-                                </article>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/91/T--NKU_China--notebook-1-5-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are <i>lsrACDB</i> fragement, No.2 are linearized T-vector.)
+                                     </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment4-5">
+                            <div class="p">
+                                The gene cloning process was repeated but there were still some mutations.
+                            </div>
+                        </div>
+                        <div id="fragment4-6">
+                            <div class="p">
+                                 We finally decided to request the gene company to synthesize the lsrACDB gene.
                              </div>
                          </div>
                      </div>
                  </div>
-                <div class="accordion-fragment">
+            </div>
-                    <div class="accordion-header">
+            <div class="accordion-fragment" id="week5">
-                        <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Member&#10113;
+                <div class="accordion-header">
-                    </div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week5 (Jun 13&ndash;Jun 19)
-                    <div class="accordion-content">
+                </div>
-                        <div class="tabs" id="member2-tabs">
+                <div class="accordion-content">
-                            <ul>
+                    <div class="tabs" id="tabs5">
-                                <li><a href="#fragment3-8">Ziying Ke</a></li>
+                        <ul>
-                                <li><a href="#fragment3-9">Xiong Yvxiu</a></li>
+                            <li><a href="#fragment5-1">begin</a></li>
-                                <li><a href="#fragment3-10">Zhuoer Dong</a></li>
+                            <li><a class="circle-number" href="#fragment5-2">&#10112;</a></li>
-                                <li><a href="#fragment3-11">Liangti Dai</a></li>
+                            <li><a class="circle-number" href="#fragment5-3">&#10113;</a></li>
-                                <li><a href="#fragment3-12">Xianglin Zhao</a></li>
+                            <li><a class="circle-number" href="#fragment5-4">&#10114;</a></li>
-                                <li><a href="#fragment3-13">Chen Chen</a></li>
+                            <li><a class="circle-number" href="#fragment5-5">&#10115;</a></li>
-                                <li><a href="#fragment3-14">Jindi Zhou</a></li>
+                        </ul>
-                            </ul>
+                        <div id="fragment5-1">
-                            <div id="fragment3-8">
+                            <div class="p">
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                 This week, we started to construct another controller&#8213;supplier.
-                                <article class="personal-description">
-                                    <div class="h3">Ziying Ke</div>
-                                    <div class="p">
-                                    </div>
-                                 </article>
                              </div>
-                             <div id="fragment3-9">
+                        </div>
-                                 <img src="https://static.igem.org/mediawiki/2016/f/fc/T--NKU_China--xiongyuxiu-4-3-1366.jpg">
+                             <div id="fragment5-2">
-                                 <article class="personal-description">
+                                 <div class="p">
-                                     <div class="h3">Xiong Yvxiu</div>
+                                    A strong promoter <i>C2</i> was cloned from former kit and <i>luxS</i> gene was cloned from GR286.
+                                </div>
-                                    <div class="p">
+                                 <div class="flex-container">
-                                        I&#39;m Xiong Yuxiu, a member of team NKU_CHINA and mainly contribute in experiment part. Being a biology-majoring sophomore, this is my first year taking part in iGEM. I LOVE challenges and iGEM gives me the chance to experience the thrills of trying different ideas in the field of synthetic biology by means of molecular biology and microbiology. The most exciting thing to me , is when results are not what we thought to be, and the team brainstorms to come up with possible explanations and new experimental designs. Being in iGEM team is my first time to complete a project from scratch and it feels awesome. This is the third year my school takes part in iGEM and not long ago our team had our own lab. We have every reason to believe that with experience accumulated, our iGEM team will be better with our joint efforts.
+                                     <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-1-1">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>p-C2</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
                                      </div>
+                                    <div class="table-wrapper">
-                                </article>
+                                        <div class="rbrace">&#125;</div>
-                            </div>
+                                        <table class="table-theme-2" id="table5-1-2">
-                            <div id="fragment3-10">
+                                            <caption>PCR reaction condition</caption>
-                                <img src="https://static.igem.org/mediawiki/2016/a/a6/T--NKU_China--dongzhuoer-1366.jpg">
+                                            <tr>
-                                <article class="personal-description">
+                                                <td>94<sup>o</sup>C</td>
-                                    <div class="h3">Zhuoer Dong</div>
+                                                <td>10 min</td>
+                                                <td></td>
-                                    <div class="p">
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>58<sup>o</sup>C</td>
+                                                <td>15 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
                                      </div>
+                                    <div class="table-wrapper">
-                                 </article>
+                                        <table class="table-theme-1" id="table5-1-3">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Bacterium solution</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>GR286</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-1-4">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/d/dc/T--NKU_China--notebook-1-5-8.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                            (NO.1&amp;2 are <i>C2</i>, No.3&amp;4 are <i>luxS</i>)
+                                        </figcaption>
+                                    </figure>
+                                 </div>
                              </div>
-                             <div id="fragment3-11">
+                             <div id="fragment5-3">
-                                 <img src="https://static.igem.org/mediawiki/2016/b/be/T--NKU_China--dailiangti-1366.jpg">
+                                 <div class="p">
-                                 <article class="personal-description">
+                                    Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5&alpha;.
-                                     <div class="h3">Liangti Dai</div>
+                                </div>
+                                 <div class="flex-container">
-                                    <div class="p">
+                                     <div class="table-wrapper">
-                                         This summer I mainly work on the conduction of the Measurement tract and the construction of standard parts.
+                                        <table class="table-theme-1" id="table5-2-1">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i></td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>17&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                         </table>
                                      </div>
-                                     <div class="p">
+                                     <div class="table-wrapper">
-                                         Working on iGEM has allowed me to think of life science through a complete different way&#39;to design a life purposely, to test the possibilities. The construction of standardizing parts is filled with weird and constant error results that had nearly driven me crazy, but they are the key moments for creativity and analysis. It&#39;s cool to cooperate with diverse people and have brain storms from time to time. It&#39;s a wonderful experience of my life.
+                                         <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-2-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>40 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
                                      </div>
+                                    <div class="table-wrapper">
-                                 </article>
+                                        <table class="table-theme-3" id="table5-2-3">
+                                            <caption>20&mu;L ligation system</caption>
+                                            <tr>
+                                                <td>10&times; DNA Ligase Buffer</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>T4 DNA Ligase</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>pMD19 T-Simple Vector</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>C2-luxS</i></td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>12&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                 </div>
                              </div>
-                             <div id="fragment3-12">
+                             <div id="fragment5-4">
-                                 <img src="https://static.igem.org/mediawiki/2016/c/c6/T--NKU_China--zhaoxianglin-1366.jpg">
+                                 <div class="p">
-                                 <article class="personal-description">
+                                    Positive clones were selected by colony PCR.
-                                     <div class="h3">Zhao Xianglin (Hilda)</div>
+                                </div>
-                                    <div class="h4">Junior</div>
+                                 <div class="flex-container">
-                                    <div class="h4">College of Life Sciences</div>
+                                     <div class="table-wrapper">
-                                    <div class="p">
+                                        <table class="table-theme-1" id="table5-3-1">
-                                        An amateur graphic designer.(I&#39;m one of the main designers of the logo!) Outgoing enough to work out of bench and enjoy the process of communication. Interested in Synbio, Gut microbiota and Nutrition.
+                                            <caption>20&mu;L PCR system</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>10&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>M13-F</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>M13-R</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Bacterium solution</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                        </table>
                                      </div>
-                                 </article>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-3-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>40 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/c/c9/T--NKU_China--notebook-1-5-9.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                    </figure>
+                                 </div>
                              </div>
-                             <div id="fragment3-13">
+                             <div id="fragment5-5">
-                                 <img src="https://static.igem.org/mediawiki/2016/1/19/T--NKU_China--chenchen-1366.jpg">
+                                 <div class="p">
-                                 <article class="personal-description">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
-                                     <div class="h3">Chen Chen</div>
+                                </div>
+                                 <div class="flex-container">
-                                    <div class="p">
+                                     <div class="table-wrapper">
-                                         I am Chen Chen from Nankai University. As you can tell from the picture,I am an outgoing and energetic girl. I love doing all kinds of field work,related to observing and recording the behavior of animals and plants. Also,I enjoy lab work very much. Although  I am just an undergraduate student, I still try to grasp every opportunity to learn about science. And also,having the chance to confirm the results of science really makes me excited. I guess that's the original motive to devote myself to science.
+                                        <table class="table-theme-4" id="table5-4-1">
+                                            <caption>20&mu;L digestion  system</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>BamH &#8544;</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>T-<i>lsrACDB</i></td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                         </table>
                                      </div>
+                                    <figure>
-                                 </article>
+                                        <img src="https://static.igem.org/mediawiki/2016/f/fb/T--NKU_China--notebook-1-5-10.png">
+                                        <figcaption>
+                                            <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                            (No.1 are linearized T-vector, No.2 are <i>C2-luxS</i> fragment.)
+                                        </figcaption>
+                                    </figure>
+                                 </div>
                              </div>
-                             <div id="fragment3-14">
+                        </div>
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                </div>
-                                 <article class="personal-description">
+            </div>
-                                     <div class="h3">Jindi Zhou</div>
+            <div class="accordion-fragment" id="week6">
+                <div class="accordion-header">
-                                     <div class="p">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week6 (Jun 20&ndash;Jun 26)
+                </div>
-                                     </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs6">
+                        <ul>
+                             <li><a class="circle-number" href="#fragment6-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment6-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment6-3">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment6-4">&#10115;</a></li>
+                            <li><a class="circle-number" href="#fragment6-5">&#10116;</a></li>
+                        </ul>
+                        <div id="fragment6-1">
+                            <div class="p">
+                                 The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-<i>C2-luxS</i> from DH5&alpha;. Then the fragment <i>C2-luxS</i> was obtained by digestion and gel extraction.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table6-1-1">
+                                        <caption>40&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>C2-luxS</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-2">
+                            <div class="p">
+                                The <i>C2-luxS</i> fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table6-2-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>C2-luxS</i></td>
+                                            <td>5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>11&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-3">
+                            <div class="p">
+                                The plasmid pWH-<i>C2-luxS</i> was extracted from DH5&alpha;. To prevent the plasmid from DAM&DCM methylation, we transformed it into <i>E.coli</i> JM110.
+                            </div>
+                        </div>
+                        <div id="fragment6-4">
+                            <div class="p">
+                                The plasmid pWH-<i>C2-luxS</i> was extracted from JM110,and then it was treated with BamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-5">
+                            <div class="p">
+                                The plasmid was transformed into GR286 by electroporation.[Failed]
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e0/T--NKU_China--notebook-6-13-1.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week7">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week7 (Jun 27&ndash;Jul 03)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment7-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment7-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment7-3">&#10114;</a></li>
+                        </ul>
+                        <div id="fragment7-1">
+                            <div class="p">
+                                This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.
+                            </div>
+                        </div>
+                        <div id="fragment7-2">
+                            <div class="p">
+                                We considered whether the <i>luxS</i> gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.
+                            </div>
+                        </div>
+                        <div id="fragment7-3">
+                            <div class="p">
+                                The plasmid pWH1520 contains a strong <i>xylA</i> promoter originating from <i>Bacillus megaterium</i>, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/eb/T--NKU_China--notebook-6-13-2.png">
+                                    <figcaption>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week8">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week8 (Jul 04&ndash;Jul 10)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs8">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment8-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment8-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment8-3">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment8-4">&#10115;</a></li>
+                        </ul>
+                        <div id="fragment8-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from GR286 using our new primers.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table8-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3a/T--NKU_China--notebook-6-13-3.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                 </figure>
+                            </div>
+                        </div>
+                        <div id="fragment8-2">
+                            <div class="p">
+                                The <i>luxS</i> fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                     <table class="table-theme-4" id="table8-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table8-2-2">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment8-3">
+                            <div class="p">
+                                Positive clones were selected by colony PCR.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                     <table class="table-theme-1" id="table8-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/49/T--NKU_China--notebook-6-13-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment8-4">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                     <table class="table-theme-4" id="table8-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxs</i></td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/35/T--NKU_China--notebook-6-13-5.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pWH1520, No.2 are <i>luxS</i> fragments.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
-                                 </article>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week9">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week9 (Jul 11&ndash;Jul 17)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs9">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment9-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment9-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment9-3">&#10114;</a></li>
+                            <li><a href="#fragment9-4">end</a></li>
+                        </ul>
+                        <div id="fragment9-1">
+                            <div class="p">
+                                 The sequencing result showed there&#39;s three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-<i>luxS</i> plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
+                            </div>
+                        </div>
+                        <div id="fragment9-2">
+                            <div class="p">
+                                the plasmid pWH-<i>luxS</i> was extracted from JM110,and it was treated withBamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment9-3">
+                            <div class="p">
+                                The plasmid was transformed into GR286 by electroporation, and positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-6-13-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment9-4">
+                            <div class="p">
+                                The construction of supplier was accomplished!
                              </div>
                          </div>
                      </div>
                  </div>
-                <div class="accordion-fragment">
+            </div>
-                    <div class="accordion-header">
+            <div class="accordion-fragment" id="week10">
-                        <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Member&#10114;
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week10 (Jul 18&ndash;Jul 24)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs10">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment10-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment10-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment10-1">
+                            <div class="p">
+                                We have received the product of synthetic <i>lsrACDB</i> gene. We first used restriction-ligation method to ligate <i>lsrACDB</i> to plasmid pWH1520, but we failed to select positive after several tries.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table10-1-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment10-2">
+                            <div class="p">
+                                Considering that the <i>lsrACDB</i> gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The <i>lsrACDB</i> sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5&alpha;. After that, verification PCR was used to select the positive clones. However, we didn&#39;t get a good result.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/1/17/T--NKU_China--notebook-6-13-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.6 is positive control, No.1-5 are experimental groups)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
                      </div>
-                     <div class="accordion-content">
+                </div>
-                         <div class="tabs" id="member3-tabs">
+            </div>
+            <div class="accordion-fragment" id="week11">
+                <div class="accordion-header">
+                     <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week11 (Jul 25&ndash;Jul 31)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs10">
+                         <ul>
+                            <li><a class="circle-number" href="#fragment11-1">&#10112;</a></li>
+                        </ul>
+                        <div id="fragment11-1">
+                            <div class="p">
+                                We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our <i>lsrACDB</i> gene. It&#39;s encouraging that we succeeded to ligate the <i>lsrACDB</i> gene to the plasmid pHT-01.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c2/T--NKU_China--notebook-6-13-8.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.3-6 are positive clones)
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/7a/T--NKU_China--notebook-6-13-9.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.2&amp;3 are positive results.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week12">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week12 (Aug 1&ndash;Aug 7)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs12">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment12-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment12-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment12-1">
+                            <div class="p">
+                                Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-6" id="table12-1-1">
+                                        <caption>Groups divided in this experiment</caption>
+                                        <tr>
+                                            <td>GR286</td>
+                                            <td>wild strain as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GR286&Delta;<i>luxS</i></td>
+                                            <td>GR286 without <i>luxS</i> gene</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i></td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i> &plus; xyl</td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>empty plasmid in GR286 as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-<i>lsrACDB</i></td>
+                                            <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-01</td>
+                                            <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/ad/T--NKU_China--notebook-6-13-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>OD<sub>600</sub> of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/00/T--NKU_China--notebook-6-13-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of GR286 and GR286&Delta;<i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pWH-<i>luxS</i>, pWH-<i>luxS</i> &plus; xyl and pWH1520</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/6b/T--NKU_China--notebook-6-13-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pHT-<i>lsrACDB</i> and pHT-01</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment12-2">
+                            <div class="p">
+                                Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a4/T--NKU_China--notebook-6-13-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of different groups</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week13">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week13 (Aug 8&ndash;Aug 14)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs12">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment13-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment13-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment13-1">
+                            <div class="p">
+                                For our consumer, we should also overexpress the <i>lsrK</i> and <i>lsrFG</i> gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1&3&4 are positive results. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment13-2">
+                            <div class="p">
+                                We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f1/T--NKU_China--notebook-6-13-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of BB170 and co-culture medium</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week14">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week14 (Aug 15&ndash;Aug 21)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs14">
+                        <ul>
+                            <li><a href="#fragment14">begin</a></li>
+                            <li><a href="#fragment14-0">outline</a></li>
+                            <li><a href="#fragment14-1-1">1.1</a></li>
+                            <li><a href="#fragment14-1-2">1.2</a></li>
+                            <li><a href="#fragment14-1-3">1.3</a></li>
+                        </ul>
+                        <div id="fragment14">
+                            <div class="p">Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with <i>Escherichia coli</i> whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.</div>
                              <ul>
-                                 <li><a href="#fragment3-15">Annie Kong</a></li>
+                                 <li>
-                                <li><a href="#fragment3-16">Jeff Bae</a></li>
+                                    The strains to be constructed are shown in the tables below.
-                                <li><a href="#fragment3-17">Mengxian Zhang</a></li>
+                                    <div class="flex-container">
-                                <li><a href="#fragment3-18">Xinhao Song</a></li>
+                                        <div class="table-wrapper">
-                                <li><a href="#fragment3-19">Zhaoran Zhang</a></li>
+                                            <table class="table-theme-0" style="font-weight:bold">
-                                <li><a href="#fragment3-20">Jingzhe Dong</a></li>
+                                                <caption>AI-2 supplier</caption>
-                            </ul>
+                                                <tr>
-                            <div id="fragment3-15">
+                                                    <td></td>
-                                <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                                    <td>LuxS</td>
-                                <article class="personal-description">
+                                                    <td>Mtn</td>
-                                    <div class="h3">Annie Kong</div>
+                                                </tr>
+                                                <tr>
-                                    <div class="p">
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS-Mtn</td>
+                                                    <td>Induced</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="font-weight:bold">
+                                                <caption>AI-2 consumer</caption>
+                                                <tr>
+                                                    <td></td>
+                                                    <td>LsrACDB</td>
+                                                    <td>LsrK</td>
+                                                    <td>LsrFG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDB</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrFG</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrK</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBFG</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>plsrACDBFGK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
                                      </div>
+                                </li>
+                                <li>
+                                    The sequences of <i>lsrACDB</i>, <i>lsrFG</i>, <i>lsrK</i>, <i>luxS</i>, <i>mtn</i> gene in <i>E.coli K12</i> were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
+                                    <div class="flex-container">
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="word-break:break-all">
+                                                <caption>Primers used in the construction of AI-2 controller</caption>
+                                                <tr>
+                                                    <td style="min-width:7.5rem">Primer name</td>
+                                                    <td>Sequence</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-R</td>
+                                                    <td>TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-F</td>
+                                                    <td>TGTTTGGCGTTTCCGCGATTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-R</td>
+                                                    <td>GCACTCTCACACCACGTTGCATGGCGCGTTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-F</td>
+                                                    <td>GTGGTGTGAGAGTGCTGAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-R</td>
+                                                    <td>ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-F</td>
+                                                    <td>CTCGGCGGTTCCGGTGCGAT</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-F</td>
+                                                    <td>ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-R</td>
+                                                    <td>GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-F</td>
+                                                    <td>TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-R</td>
+                                                    <td>TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Fd</td>
+                                                    <td>GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Rv</td>
+                                                    <td>GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Fd</td>
+                                                    <td>GGGGTACCCCATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Rv</td>
+                                                    <td>GGAATTCCCTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Fd</td>
+                                                    <td>CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Rv</td>
+                                                    <td>GAAGATCTTCTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-F</td>
+                                                    <td>AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-R</td>
+                                                    <td>TTCGAACTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>BK-JC-F</td>
+                                                    <td>TTTCAGTGTATGTCGCGGATGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>GK-JC-F</td>
+                                                    <td>TTGCGCTTCGATGTCTTACAGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-F</td>
+                                                    <td>TGGGCACTCGACCGGAATTATC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-R</td>
+                                                    <td>GCTACTGCCGCCAGGCAAATTC</td>
+                                                </tr>
+                                            </table>
-                                 </article>
+                                        </div>
+                                    </div>
+                                 </li>
+                            </ul>
+                        </div>
+                        <div id="fragment14-0">
+                            <ol>
+                                <li>Construction of pLuxS-Mtn</li>
+                            </ol>
+                        </div>
+                        <div id="fragment14-1-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
                              </div>
-                             <div id="fragment3-16">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                <div class="table-wrapper">
-                                 <article class="personal-description">
+                                    <table class="table-theme-1" id="table14-1-1-1-1">
-                                     <div class="h3">Jeff Bae</div>
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
-                                     <div class="p">
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
-                                     </div>
+                                        </tr>
+                                        <tr>
-                                 </article>
+                                            <td><i>luxS</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-14-17-01.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                 </figure>
+                                <div class="table-wrapper">
+                                     <table class="table-theme-1" id="table14-1-1-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                     <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>45 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                     </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/66/T--NKU_China--notebook-14-17-02.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>mtn</i></span></div>
+                                    </figcaption>
+                                 </figure>
                              </div>
-                            <div id="fragment3-17">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/4/4c/T--NKU_China--zhangmengxian-1366.jpg">
+                        <div id="fragment14-1-2">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Mengxian Zhang</div>
+                                ClonExpress technique was used to ligate <i>luxS</i> and <i>mtn</i> genes to plasmid pTrcHisB. The recombinant vector pTrc-<i>luxS</i>-<i>mtn</i> was transformed into <i>E.coli K12</i>. After that, verification PCR was performed to select the positive clones.
-                                    <div class="p">
-                                    </div>
-                                </article>
                              </div>
-                             <div id="fragment3-18">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/6/68/T--NKU_China--songxinghao-1366.jpg">
+                                <div class="table-wrapper">
-                                <article class="personal-description">
+                                    <table class="table-theme-1" id="table14-1-1-2-1">
-                                    <div class="h3">Xinhao Song</div>
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
-                                    <div class="p">
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
-                                         I am the student team leader and a member of the experiment division of iGEM 2016 Team NKU_China. Besides the overall management of the team, I am also mainly responsible for the conduction of the Measurement tract and the construction of standard parts. My devotion to synthetic biology is due to the fact that even the simplest bacteria are much more delicate than the most complex machines that humans have ever built. The perfection and complexity of life system attracts me to learn and discover.
+                                            <td>10&mu;L</td>
-                                     </div>
+                                        </tr>
+                                        <tr>
-                                 </article>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e4/T--NKU_China--notebook-14-17-03.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                         (NO.3&amp;5&amp;8 are positive results)
+                                     </figcaption>
+                                 </figure>
                              </div>
-                            <div id="fragment3-19">
+                        </div>
-                                <img src="https://static.igem.org/mediawiki/2016/d/dc/T--NKU_China--zhangzhaoran-4-3-1366.jpg">
+                        <div id="fragment14-1-3">
-                                <article class="personal-description">
+                            <div class="p">
-                                    <div class="h3">Zhaoran Zhang</div>
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
-                                    <div class="p">
-                                    </div>
-                                 </article>
                              </div>
-                             <div id="fragment3-20">
+                             <div class="flex-container">
-                                 <img src="https://static.igem.org/mediawiki/2016/4/4f/T--NKU_China--chenlingyi-1366.jpg">
+                                <div class="table-wrapper">
-                                 <article class="personal-description">
+                                    <table class="table-theme-4" id="table14-1-3-1-1">
-                                     <div class="h3">Jingzhe Dong</div>
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
-                                     <div class="p">
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i>-<i>mtn</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                 </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/83/T--NKU_China--notebook-14-17-04.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pTrcHisB, No.2 are <i>luxS</i>-<i>mtn</i> fragment. )
+                                    </figcaption>
+                                 </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week15">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week15 (Aug 22&ndash;Aug 28)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs15">
+                        <ul>
+                            <li><a href="#fragment15-0">outline</a></li>
+                            <li><a href="#fragment15-1-1">1.1</a></li>
+                            <li><a href="#fragment15-1-2">1.2</a></li>
+                            <li><a href="#fragment15-1-3">1.3</a></li>
+                            <li><a href="#fragment15-1-4">1.4</a></li>
+                            <li><a href="#fragment15-2-1">2.1</a></li>
+                            <li><a href="#fragment15-2-2">2.2</a></li>
+                            <li><a href="#fragment15-2-3">2.3</a></li>
+                            <li><a href="#fragment15-3-1">3.1</a></li>
+                            <li><a href="#fragment15-3-2">3.2</a></li>
+                            <li><a href="#fragment15-3-3">3.3</a></li>
+                        </ul>
+                        <div id="fragment15-0">
+                            <ol>
+                                <li>Construction of pLuxS</li>
+                                <li>Construction of pLsrACDB</li>
+                                <li>Construction of pLsrACDBFG</li>
+                            </ol>
+                        </div>
+                        <div id="fragment15-1-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                     <table class="table-theme-1" id="table15-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                     </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/bc/T--NKU_China--notebook-14-17-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-2">
+                            <div class="p">
+                                The <i>luxS</i> gene was purified by gel extraction. Then, both the <i>luxS</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>luxS</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table15-1-2-1">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i></td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
                                      </div>
+                                    <div class="table-wrapper">
-                                 </article>
+                                        <table class="table-theme-4" id="table15-1-2-2">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>pTrcHisB</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>12&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <table class="table-theme-3" id="table15-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>50 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/65/T--NKU_China--notebook-14-17-06.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-4">
+                            <div class="p">
+                                One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/ca/T--NKU_China--notebook-14-17-07.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 is linearized pTrcHisB &plus; <i>luxS</i>, No.2 is plasmid pTrc-<i>luxS</i>. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-2-1-3">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min 20 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b6/T--NKU_China--notebook-14-17-08.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDB1</i>,<i>lsrACDB1</i>2</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e1/T--NKU_China--notebook-14-17-09.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-2-3-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5d/T--NKU_China--notebook-14-17-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-3-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/69/T--NKU_China--notebook-14-17-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDBFG</i>1,<i>lsrACDBFG</i>2, <i>lsrACDBFG</i>3</span>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/97/T--NKU_China--notebook-14-17-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-3-2-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-14-17-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1-4 are linearized pTrcHisB &plus; <i>lsrACDBFG</i>, No.5 is plasmid pTrc-<i>lsrACDBFG</i>.)
+                                    </figcaption>
+                                 </figure>
                              </div>
                          </div>
                      </div>
                  </div>
              </div>
-         </main>
+            <div class="accordion-fragment" id="week16">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week16 (Aug 29&ndash;Sep 04)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs16">
+                        <ul>
+                            <li><a href="#fragment16-0">outline</a></li>
+                            <li><a href="#fragment16-1-1">1.1</a></li>
+                            <li><a href="#fragment16-1-2">1.2</a></li>
+                            <li><a href="#fragment16-1-3">1.3</a></li>
+                            <li><a href="#fragment16-1-4">1.4</a></li>
+                            <li><a href="#fragment16-2-1">2.1</a></li>
+                            <li><a href="#fragment16-2-2">2.2</a></li>
+                            <li><a href="#fragment16-2-3">2.3</a></li>
+                            <li><a href="#fragment16-2-4">2.4</a></li>
+                            <li><a href="#fragment16-3-1">3.1</a></li>
+                            <li><a href="#fragment16-3-2">3.2</a></li>
+                            <li><a href="#fragment16-3-3">3.3</a></li>
+                            <li><a href="#fragment16-3-4">3.4</a></li>
+                        </ul>
+                        <div id="fragment16-0">
+                            <ol>
+                                <li>Construction of pLsrFG</li>
+                                <li>Construction of pLsrACDBK</li>
+                                <li>Construction of pLsrACDBFGK</li>
+                            </ol>
+                        </div>
+                        <div id="fragment16-1-1">
+                            <div class="p">
+                                <i>lsrFG</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 15 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5c/T--NKU_China--notebook-14-17-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrFG</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-2">
+                            <div class="p">
+                                The <i>lsrFG</i> gene was purified by gel extraction. Then, both the <i>lsrFG</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>lsrFG</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrcHisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxSFG</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5b/T--NKU_China--notebook-14-17-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrFG</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b0/T--NKU_China--notebook-14-17-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDB</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDB</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-2-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/cb/T--NKU_China--notebook-14-17-18.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/56/T--NKU_China--notebook-14-17-19.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBFG</i></td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-3-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDFGB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/78/T--NKU_China--notebook-14-17-20.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO.3 is positive result)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBKFGK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e2/T--NKU_China--notebook-14-17-21.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week17">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week17 (Sep 05&ndash;Sep 11)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs17">
+                        <ul>
+                            <li><a href="#fragment17-0">outline</a></li>
+                            <li><a href="#fragment17-1-1">1.1</a></li>
+                            <li><a href="#fragment17-1-2">1.2</a></li>
+                            <li><a href="#fragment17-1-3">1.3</a></li>
+                            <li><a href="#fragment17-1-4">1.4</a></li>
+                        </ul>
+                        <div id="fragment17-0">
+                            <ol>
+                                <li>Construction of pLsrK</li>
+                            </ol>
+                        </div>
+                        <div id="fragment17-1-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-2-1">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/24/T--NKU_China--notebook-14-17-22.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-HisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table17-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/30/T--NKU_China--notebook-14-17-23.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-4">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/22/T--NKU_China--notebook-14-17-24.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week18">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week18 (Seq 12&ndash;Seq 18)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment18-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment18-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment18-1">
+                            <div class="p">
+                                We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f8/T--NKU_China--notebook-18-20-01.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>Relative expression of several overexpressed genes at the mRNA level</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment18-2">
+                            <div class="p">
+                                SDS-PAGE was performed to detect the expression of these genes at the protein level.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d2/T--NKU_China--notebook-18-20-02.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week19">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week19 (Seq 19&ndash;Seq 25)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment19-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment19-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment19-1">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/4c/T--NKU_China--notebook-18-20-03.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of suppliers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-18-20-04.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of consumers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment19-2">
+                            <div class="p">
+                                HPLC was performed to detect the production of AI-2 of the strain pLuxS.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d9/T--NKU_China--notebook-18-20-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>HPLC result of AI-2 production of luxS overexpression strain and negative control</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week20">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week20 (Seq 26&ndash;Oct 02)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment20-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment20-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment20-1">
+                            <div class="p">
+                                Biofilm studies and evaluation:<br>
+                                pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 &mu;L at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (&plus;/&minus;30 min) at 30 <sup>o</sup>C in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 &mu;L of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 <sup>o</sup>C  with the lid off for 60 min, and afterwards, 250 &mu;L of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 &mu;L of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-18-20-06.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/8b/T--NKU_China--notebook-18-20-07.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment20-2">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/ed/T--NKU_China--notebook-18-20-08.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 output profiles of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/04/T--NKU_China--notebook-18-20-09.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 uptake profiles of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+         </div>
+    </div>
 </body>
 </html>
+{{NKU_China/footer}}