Difference between revisions of "Team:NAU-CHINA/Basic Part"

 
(3 intermediate revisions by the same user not shown)
Line 84: Line 84:
 
                 background-color:white;
 
                 background-color:white;
 
             }
 
             }
−
             #maintext ol,p,h2{
+
             #maintext ol,h2{
 
             padding-left: 60px;
 
             padding-left: 60px;
 
padding-right: 70px;
 
padding-right: 70px;
Line 91: Line 91:
 
                 font-size:17px;
 
                 font-size:17px;
 
             }
 
             }
 +
#maintext p{
 +
            padding-left: 60px;
 +
padding-right: 70px;
 +
font-family:'Comic Sans MS','Arial Black';
 +
color: rgb(100,100,100);
 +
                font-size:17px;
 +
            }
 +
#maintext .imgbox{
 +
text-align: center;
 +
margin: 0 auto;
 +
}
 
             #maintext a{
 
             #maintext a{
 
             text-decoration: none;
 
             text-decoration: none;
Line 125: Line 136:
 
             color: red;
 
             color: red;
 
             }
 
             }
 +
#maintext #table01{
 +
margin-left:35%;
 +
text-align: center;
 +
}
 +
#maintext #table02{
 +
margin-left: 35%;
 +
text-align: center;
 +
}
 +
#maintext img{
 +
margin: 0 auto;
 +
text-align: center;
 +
}
 +
#maintext .imgbox p{
 +
text-align: center;
 +
}
 
</style>
 
</style>
 
<script type="text/javascript">
 
<script type="text/javascript">
Line 233: Line 259:
  
 
<div id="maintext">
 
<div id="maintext">
−
<div style="background-color: rgba(94,247,126,0.4);">
+
<div>
 
<br><br>
 
<br><br>
 
<h1>Best Basic Part</h1>
 
<h1>Best Basic Part</h1>
−
<h2><a href="http://parts.igem.org/Part:BBa_K2088000">BBa_K2088000</a></h2>
+
<h2><a href="http://parts.igem.org/Part:BBa_K2088000"><b style="color: blue;">BBa_K2088000</b></a></h2>
 
<p style="font-family:'Comic Sans MS','Arial Black';color: rgb(100,100,100);font-size:17px;">This basic part encodes Catechol 2,3-Dioxygenase from Sphingobium sp. YBL2. This protein transforms catechol by meta-cleavage to the bright yellow product 2-hydroxymuconate semialdehyde(2-HMS). We tested it with J23100 (a strong promoter) and its native rbs before it and a double terminator after it in E.coli. It plays a great role in our project to degrade catechol to 2-HMS, a non-toxic molecule that can be metalbolized by E.coli DH5α.</p>
 
<p style="font-family:'Comic Sans MS','Arial Black';color: rgb(100,100,100);font-size:17px;">This basic part encodes Catechol 2,3-Dioxygenase from Sphingobium sp. YBL2. This protein transforms catechol by meta-cleavage to the bright yellow product 2-hydroxymuconate semialdehyde(2-HMS). We tested it with J23100 (a strong promoter) and its native rbs before it and a double terminator after it in E.coli. It plays a great role in our project to degrade catechol to 2-HMS, a non-toxic molecule that can be metalbolized by E.coli DH5α.</p>
−
<p><a href="">For more details, see our experiment of C23O.</a></p>
+
 
<br><br>
 
<br><br>
 +
 +
<h1>Verification of the function of catechol 2,3-dioxygenase from YBL2</h1>
 +
<h1>Background</h1>
 +
<p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/1/1a/T--NAU-CHINA--EX_C23O01.png">
 +
<p><b>Fig.1</b></p>
 +
</div>
 +
 +
<h1>Bacterial Strain</h1>
 +
<p>Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days. </p>
 +
<h1>Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS</h1>
 +
<p>Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG</p>
 +
<p>Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/0/0b/T--NAU-CHINA--EX_C23O02.png">
 +
<p><b>Fig.2</b></p>
 +
</div>
 +
<div id="table01">
 +
<p>PCR System(15µL):</p>
 +
<table>
 +
<tr>
 +
<td>template</td>
 +
<td>single colonies</td>
 +
</tr>
 +
<tr>
 +
<td>ddH<sub>2</sub>O</td>
 +
<td>6.9ul</td>
 +
</tr>
 +
<tr>
 +
<td>Primer</td>
 +
<td>0.5ul</td>
 +
</tr>
 +
<tr>
 +
<td>MixEx Taq<sup>TM</sup> Version</td>
 +
<td>7.5ul</td>
 +
</tr>
 +
<tr>
 +
<td>2.0 plus dye</td>
 +
<td></td>
 +
</tr>
 +
</table>
 +
<p>Total time: 1h49min</p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png">
 +
<p><b>Fig.3</b></p>
 +
</div>
 +
<div id="table02">
 +
<p>PCR System(50µL):</p>
 +
<table>
 +
<tr>
 +
<td>template</td>
 +
<td>single colonies/bacteria liquid (2µL)</td>
 +
</tr>
 +
<tr>
 +
<td>ddH<sub>2</sub>O</td>
 +
<td>23µL or 21µL</td>
 +
</tr>
 +
<tr>
 +
<td>Primer</td>
 +
<td>2µL</td>
 +
</tr>
 +
<tr>
 +
<td>MixPrime STAR</td>
 +
<td>25µL</td>
 +
</tr>
 +
 +
</table>
 +
<p>Total time: 48min</p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png">
 +
<p><b>Fig.4</b></p>
 +
 +
</div>
 +
 +
<h1>Construction of Recombinant Expression Vector</h1>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/c/ce/T--NAU-CHINA--EX_C23O05.png">
 +
<p><b>Fig.5</b></p>
 +
</div>
 +
<h1>Functional Verification</h1>
 +
<h1>Method</h1>
 +
<p><b>Step one:</b> Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.</p>
 +
<p><b>Step two:</b> Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.</p>
 +
<p>*Note that the catechol solution should be kept away from light and air.</p>
 +
<p>The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.</p>
 +
<p>*pbaC as negative control (CK).</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/0/03/T--NAU-CHINA--EX_C23O06.png">
 +
<p><b>Fig.6</b></p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/8/84/T--NAU-CHINA--EX_C23O07.png">
 +
<p><b>Fig.7</b></p>
 +
</div>
 +
 
</div>
 
</div>
 
</div>
 
</div>

Latest revision as of 17:18, 19 October 2016



Best Basic Part

BBa_K2088000

This basic part encodes Catechol 2,3-Dioxygenase from Sphingobium sp. YBL2. This protein transforms catechol by meta-cleavage to the bright yellow product 2-hydroxymuconate semialdehyde(2-HMS). We tested it with J23100 (a strong promoter) and its native rbs before it and a double terminator after it in E.coli. It plays a great role in our project to degrade catechol to 2-HMS, a non-toxic molecule that can be metalbolized by E.coli DH5α.



Verification of the function of catechol 2,3-dioxygenase from YBL2

Background

Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.

Fig.1

Bacterial Strain

Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days.

Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS

Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG

Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC

Fig.2

PCR System(15µL):

template single colonies
ddH2O 6.9ul
Primer 0.5ul
MixEx TaqTM Version 7.5ul
2.0 plus dye

Total time: 1h49min

Fig.3

PCR System(50µL):

template single colonies/bacteria liquid (2µL)
ddH2O 23µL or 21µL
Primer 2µL
MixPrime STAR 25µL

Total time: 48min

Fig.4

Construction of Recombinant Expression Vector

Fig.5

Functional Verification

Method

Step one: Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.

Step two: Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.

*Note that the catechol solution should be kept away from light and air.

The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.

*pbaC as negative control (CK).

Fig.6

Fig.7