Difference between revisions of "Team:NAU-CHINA/Basic Part"

(Prototype team page)
 
 
(8 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
{{NAU-CHINA}}
 
 
<html>
 
<html>
 +
<head>
 +
<meta charset="UTF-8" />
 +
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1">
 +
<meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
<link rel="stylesheet" type="text/css" href="https://2016.igem.org/Template:NAU-CHINA/texiao?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2016.igem.org/Template:NAU-CHINA/component?action=raw&ctype=text/css" />
 +
<style type="text/css">
 +
/* Hide top title */
 +
#top_title, #sideMenu {
 +
display: none;
 +
}
 +
 +
/* Hide first heading */
 +
.firstHeading {
 +
display: none;
 +
}
  
−
<div class="column full_size judges-will-not-evaluate">
 
−
<h3>★  ALERT! </h3>
 
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2016.igem.org/Judging/Awards#Special_Prizes">basic part special prize</a>. </p>
 
  
 +
/*-- Remove borders, float content left and remove padding/margin */
 +
#globalWrapper, #content{
 +
background-color: transparent;
 +
border: none;
 +
float: center;
 +
width: auto;
 +
margin-left: 0px;
 +
margin-top: -8px;
 +
padding: auto;
 +
}
  
 +
/*left align Black Menu Bar */
 +
#top_menu_inside {
 +
margin-left: 0px;
 +
}
 +
.centerImage
 +
{
 +
text-align:center;
 +
display:block;
 +
}
 +
.wraptocenter {
 +
  display: table-cell;
 +
  text-align: center;
 +
  vertical-align: middle;
 +
  width: 200px;
 +
  height: 200px;
 +
  background-color: #999;
 +
}
 +
.wraptocenter * {
 +
  vertical-align: middle;
 +
}
 +
            #top_menu_inside .submenu{min-height:250px;}
  
−
<p> Delete this box in order to be evaluated for this medal. See more information at <a href="https://2016.igem.org/Judging/Pages_for_Awards/Instructions"> Instructions for Pages for awards</a>.</p>
+
            @media screen and (max-width: 1220px) {
−
</div>
+
  
 +
    .menu{
 +
        display: none;
 +
       
 +
    }
  
 +
    .container {
 +
        display: block;
 +
    }
  
 +
}
  
−
<div class="column full_width">
+
@media screen and (min-width: 1220px) {
  
 +
    .menu{
 +
        display: block;
 +
    }
  
 +
    .container {
 +
        display: none;
 +
    }
  
 +
}
  
−
<p>
+
/* body style */
−
A <b>basic part</b> is a functional unit of DNA that cannot be subdivided into smaller component parts. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_R0051">BBa_R0051</a> is an example of a basic part, a promoter regulated by lambda cl.
+
#maintext{
−
</p>
+
padding: 400px 120px 0 120px;
 +
 +
            }
 +
            body{
 +
                background-color:white;
 +
            }
 +
            #maintext ol,h2{
 +
            padding-left: 60px;
 +
padding-right: 70px;
 +
font-family:'Comic Sans MS','Arial Black';
 +
color: rgb(100,100,100);
 +
                font-size:17px;
 +
            }
 +
#maintext p{
 +
            padding-left: 60px;
 +
padding-right: 70px;
 +
font-family:'Comic Sans MS','Arial Black';
 +
color: rgb(100,100,100);
 +
                font-size:17px;
 +
            }
 +
#maintext .imgbox{
 +
text-align: center;
 +
margin: 0 auto;
 +
}
 +
            #maintext a{
 +
            text-decoration: none;
 +
            font-family:'Comic Sans MS','Arial Black';
 +
            color: rgb(100,100,100);
 +
            }
 +
#maintext h1{
 +
            padding-left: 60px;
 +
padding-right: 70px;
 +
font-family:'Comic Sans MS','Arial Black';
 +
color: rgb(100,100,100);
 +
            }
  
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are <b>many</b> opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. </p>
 
  
 +
#maintext #imgbox{
 +
padding-left: 20%;
 +
}
 +
                        #biaodan a{color: rgb(100,100,100);}
 +
                        #biaodan a:visited{font-family:'Comic Sans MS','Arial Black';}
 +
                        #biaodan #lianjie{font-size:24px;}
 +
                        #ClickBack{
 +
text-align: center;
 +
position: fixed;
 +
bottom: 2%;
 +
right: 2%;
 +
                        font-family:'Comic Sans MS','Arial Black';
 +
}
  
 +
#ClickBack img{
 +
width: 100px;
 +
}
 +
                #biaodan #wenxian{padding-left:30px;font-size:17px;}
 +
            #hongde{
 +
            color: red;
 +
            }
 +
#maintext #table01{
 +
margin-left:35%;
 +
text-align: center;
 +
}
 +
#maintext #table02{
 +
margin-left: 35%;
 +
text-align: center;
 +
}
 +
#maintext img{
 +
margin: 0 auto;
 +
text-align: center;
 +
}
 +
#maintext .imgbox p{
 +
text-align: center;
 +
}
 +
</style>
 +
<script type="text/javascript">
  
 +
function ChangeImg(ThisPic)
 +
{
 +
var size=document.body.clientWidth;
 +
var TrueWidth=ThisPic.width;
 +
var TrueHeight=ThisPic.height;
 +
var Multiple=TrueWidth/size;
  
 +
ThisPic.width=size;
 +
ThisPic.height=TrueHeight/Multiple;
 +
}
  
−
<div class="highlight">
+
</script>
−
<h4>Note</h4>
+
−
<p>This page should list all the basic parts your team has made during your project. You must add all characterization information for your parts on the Registry. You should not put characterization information on this page.</p>
+
  
  
−
</div>
+
</head>
 +
<body>
 +
<!-- small screen menu -->
 +
 +
<div class="container" >
 +
<ul id="gn-menu" class="gn-menu-main" >
 +
<li class="gn-trigger">
 +
<a class="gn-icon gn-icon-menu">
 +
</a>
 +
<nav class="gn-menu-wrapper">
 +
<div class="gn-scroller">
 +
<ul class="gn-menu">
 +
<li>
 +
<a href="https://2016.igem.org/Team:NAU-CHINA"><span> HOME</span></a>
 +
</li>
 +
<li>
 +
<a href="https://2016.igem.org/Team:NAU-CHINA/Participator"> TEAM</a>
 +
</li>
 +
<li>
 +
<a href="https://2016.igem.org/Team:NAU-CHINA/Description"> PROJECT</a>
 +
</li>
 +
<li>
 +
<a href="https://2016.igem.org/Team:NAU-CHINA/Part_Collection"> PARTS</a>
 +
</li>
 +
<ul>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Part_List">Part List</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Basic_Part">Basic Part</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Composite_Part">Composite Part</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Part_Collection">Collection</a></li>
 +
</ul>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Safety"> SAFETY</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Attributions"> ATTRIBUTION</a></li>
 +
<li>
 +
<a href="https://2016.igem.org/Team:NAU-CHINA/Human_Practices"> HP</a>
 +
</li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Conclusion">CONCLUSION</a></li>
 +
</ul>
 +
</div><!-- /gn-scroller -->
 +
</nav>
 +
</li>
 +
</ul>
  
 +
</div><!-- /container -->
 +
 +
 +
 +
<nav>
 +
<!-- big screen menu-->
 +
<div class="nav" id="main" role="main">
 +
<ul class="menu">
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA">HOME</a></li>
 +
<li><a>TEAM</a>
 +
<ul class="submenu">
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Participator">Participator</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Collaborations">Collaboration</a></li>
 +
</ul>
 +
</li>
 +
<li><a>PROJECT</a>
 +
<ul class="submenu">
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Description">Description</a></li>
 +
                                <li><a href="https://2016.igem.org/Team:NAU-CHINA/Design">Applied Design</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Experiment">Experiment</a></li>
 +
                                <li><a href="https://2016.igem.org/Team:NAU-CHINA/Proof">Proof of Concept</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Demonstrate">Demonstrate </a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Model">Model </a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Notebook">Notebook </a></li>
 +
</ul>
 +
</li>
 +
<li><a>PARTS</a>
 +
<ul class="submenu">
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Part_List">Part List</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Basic_Part">Basic Part</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Composite_Part">Composite Part</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Part_Collection">Collection</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Safety">SAFETY</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Attributions">ATTRIBUTION</a></li>
 +
<li><a>HUMAN PRACTICE</a>
 +
<ul class="submenu">
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Human_Practices">Human Practices</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/HP/Silver">Silver</a></li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/HP/Gold">Gold</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="https://2016.igem.org/Team:NAU-CHINA/Conclusion">CONCLUSION</a></li>
 +
</ul>
 +
</div>
 +
</nav>
 +
 +
<div id="maintext">
 +
<div>
 +
<br><br>
 +
<h1>Best Basic Part</h1>
 +
<h2><a href="http://parts.igem.org/Part:BBa_K2088000"><b style="color: blue;">BBa_K2088000</b></a></h2>
 +
<p style="font-family:'Comic Sans MS','Arial Black';color: rgb(100,100,100);font-size:17px;">This basic part encodes Catechol 2,3-Dioxygenase from Sphingobium sp. YBL2. This protein transforms catechol by meta-cleavage to the bright yellow product 2-hydroxymuconate semialdehyde(2-HMS). We tested it with J23100 (a strong promoter) and its native rbs before it and a double terminator after it in E.coli. It plays a great role in our project to degrade catechol to 2-HMS, a non-toxic molecule that can be metalbolized by E.coli DH5α.</p>
 +
 +
<br><br>
 +
 +
<h1>Verification of the function of catechol 2,3-dioxygenase from YBL2</h1>
 +
<h1>Background</h1>
 +
<p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/1/1a/T--NAU-CHINA--EX_C23O01.png">
 +
<p><b>Fig.1</b></p>
 +
</div>
 +
 +
<h1>Bacterial Strain</h1>
 +
<p>Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days. </p>
 +
<h1>Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS</h1>
 +
<p>Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG</p>
 +
<p>Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/0/0b/T--NAU-CHINA--EX_C23O02.png">
 +
<p><b>Fig.2</b></p>
 +
</div>
 +
<div id="table01">
 +
<p>PCR System(15µL):</p>
 +
<table>
 +
<tr>
 +
<td>template</td>
 +
<td>single colonies</td>
 +
</tr>
 +
<tr>
 +
<td>ddH<sub>2</sub>O</td>
 +
<td>6.9ul</td>
 +
</tr>
 +
<tr>
 +
<td>Primer</td>
 +
<td>0.5ul</td>
 +
</tr>
 +
<tr>
 +
<td>MixEx Taq<sup>TM</sup> Version</td>
 +
<td>7.5ul</td>
 +
</tr>
 +
<tr>
 +
<td>2.0 plus dye</td>
 +
<td></td>
 +
</tr>
 +
</table>
 +
<p>Total time: 1h49min</p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png">
 +
<p><b>Fig.3</b></p>
 +
</div>
 +
<div id="table02">
 +
<p>PCR System(50µL):</p>
 +
<table>
 +
<tr>
 +
<td>template</td>
 +
<td>single colonies/bacteria liquid (2µL)</td>
 +
</tr>
 +
<tr>
 +
<td>ddH<sub>2</sub>O</td>
 +
<td>23µL or 21µL</td>
 +
</tr>
 +
<tr>
 +
<td>Primer</td>
 +
<td>2µL</td>
 +
</tr>
 +
<tr>
 +
<td>MixPrime STAR</td>
 +
<td>25µL</td>
 +
</tr>
 +
 +
</table>
 +
<p>Total time: 48min</p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png">
 +
<p><b>Fig.4</b></p>
 +
 +
</div>
 +
 +
<h1>Construction of Recombinant Expression Vector</h1>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/c/ce/T--NAU-CHINA--EX_C23O05.png">
 +
<p><b>Fig.5</b></p>
 +
</div>
 +
<h1>Functional Verification</h1>
 +
<h1>Method</h1>
 +
<p><b>Step one:</b> Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.</p>
 +
<p><b>Step two:</b> Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.</p>
 +
<p>*Note that the catechol solution should be kept away from light and air.</p>
 +
<p>The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.</p>
 +
<p>*pbaC as negative control (CK).</p>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/0/03/T--NAU-CHINA--EX_C23O06.png">
 +
<p><b>Fig.6</b></p>
 +
</div>
 +
<div class="imgbox">
 +
<img src="https://static.igem.org/mediawiki/2016/8/84/T--NAU-CHINA--EX_C23O07.png">
 +
<p><b>Fig.7</b></p>
 +
</div>
 +
 +
</div>
 +
</div>
  
 +
</div>
 +
<img src="https://static.igem.org/mediawiki/2016/a/a9/T--NAU-CHINA--PARTS_BG.jpeg"  onload="ChangeImg(this)" style="z-index:-60;position:absolute;left:0;top:0px"><!--backgroundimg-->
 +
<script type="text/javascript" src="https://2016.igem.org/Template:NAU-CHINA/modernizr_custom?
 +
action=raw&ctype=text/javascript"></script>
 +
<script type="text/javascript" src="https://2016.igem.org/Template:NAU-CHINA/gnmenu?
 +
action=raw&ctype=text/javascript"></script>
 +
<script type="text/javascript" src="https://2016.igem.org/Template:NAU-CHINA/classie?
 +
action=raw&ctype=text/javascript"></script>
 +
<script>
 +
new gnMenu( document.getElementById( 'gn-menu' ) );
 +
</script>
 +
</body>
 
</html>
 
</html>

Latest revision as of 17:18, 19 October 2016



Best Basic Part

BBa_K2088000

This basic part encodes Catechol 2,3-Dioxygenase from Sphingobium sp. YBL2. This protein transforms catechol by meta-cleavage to the bright yellow product 2-hydroxymuconate semialdehyde(2-HMS). We tested it with J23100 (a strong promoter) and its native rbs before it and a double terminator after it in E.coli. It plays a great role in our project to degrade catechol to 2-HMS, a non-toxic molecule that can be metalbolized by E.coli DH5α.



Verification of the function of catechol 2,3-dioxygenase from YBL2

Background

Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.

Fig.1

Bacterial Strain

Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days.

Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS

Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG

Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC

Fig.2

PCR System(15µL):

template single colonies
ddH2O 6.9ul
Primer 0.5ul
MixEx TaqTM Version 7.5ul
2.0 plus dye

Total time: 1h49min

Fig.3

PCR System(50µL):

template single colonies/bacteria liquid (2µL)
ddH2O 23µL or 21µL
Primer 2µL
MixPrime STAR 25µL

Total time: 48min

Fig.4

Construction of Recombinant Expression Vector

Fig.5

Functional Verification

Method

Step one: Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.

Step two: Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.

*Note that the catechol solution should be kept away from light and air.

The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.

*pbaC as negative control (CK).

Fig.6

Fig.7