|
|
(3 intermediate revisions by 2 users not shown) |
Line 1: |
Line 1: |
| <html> | | <html> |
| + | <!-- GACCAAGCCTGCAAAATCAAACCACTAATAAGAGGAGAAGCGCTGAAAATTCGAAGTTCTTAAGAACTTCTCCGTCATCCCTACGACAGAAGTTTTGAAGTCCTACAAGATCGAAGAATTTAAGAAAAAACTTTTAAGCCGTTCGATGCCTAAGCACTGAAGCCCTAAGCTCCCTAAGCCTTTAAGAGCTGAAGGCTTCTCAACGATTAACAGCTAAGCCTTTAAGATGTCAAATCACCAGCAGGCGAAGGGATGACCACCAGATAAAAAACTATCGAAGAATTTAAGGCCTAGGAGAAGCGTTTGCATAAGCGATGAAGTCATGCGAATAAAAAATCTGCACAACACCCTAAGTAATTTCCTAAGTATTTAAGTGATCGACGACATAAGGAGTTAAGTACTAGCCGAAGGTATTTGAGAAGTCGTAATCGAAGTATTGATCGAAGTAATGAAGAGCTTAAGCACTTAAGGAGTGAAGCGGTACCAGTTAGGGCGAAGCCGTTGGCACTCTAAGCGATGTTATCGATAAGGGCTGCAATTACCTGCTAAGAGTTTAACGAAGGTTTAGGCGAAGTCATTAAGCCATTAACGAAGTTATTGCATATCTAAGAAGTTAAGGCCTGTTCGAAGTTATGAAGCGCTCTAATAAGAACTCGAAGAAGAGCTATTCGAAGTGGTGTTATACATAAGGCGTGAAGGGCTTAACAGCATAAGTAGTGAGAGAAGTGTTGAGCTAAGCTATGAAGAAGTGAGCCATAGGTATACCTACCCGGAGAAGATGTTTTCGAAGTTGTGAAGGACTTAAGGACTTGACACAAGAAGCCTTGAAGCCATGGGCGAAGGTATGAAGACCTGAAGAGTTATCCTAAGCTGTGGCAGTGAGAAGCAGTAGACTCTATTCACCACAGCAGAAGTCGTCCCCATGACTCAGAGCTAAGAAAAAACTTTGACATAAGTATTTCTCTAAGGCGTTAAAAACCTAAGGGCTCTTAGAAGTCGTGAAGAGGTGAAGCGATTAAGCGGTGAAGAGGTCGGAGCTCTAAGTTGTTAAGCGCTTGTCGAAGAACTGAAGGCCTATTAAAACAGGCTAAGCTCTGCCAGAAGTTCTGAAGAGGTTAAGCTGTTAAGACATGAAGCGATTAGATAAGTTCTTCTCGAAGGATTCCCATAAGTACTGAAGCCGTTAAGGGATTAAGAATTATACATCCTAAGGGGTGAAGCTATGATCTTAAGAAGCCATGAAGCGCTGTACTAAGAGCTGGGCCAAACATCGAAGCGCTCGCCTAAGGATTCACAAAACTAAGTGGTTAAGTCTTGGGCTAAGGTGTGGAACAAAGAAGTGGTGAAGACGTGTTATCGAACACTAAGCTGTGAAGCAATAATCTAAGAAATTAAGGTATGAAGGACTCAACGAAGGACTGAAGCGTTTGCCGAAGAAATTAAGGCCTCGCAGAAGCATTTAAGAACTGAAGTTATATTCCCAAGAAGAGTTGAAGATGTTAAGCAGTGTCAACTCCCCAAAGAATACGAAGGGTTTTCCAGGCATTATCCAGAAGTCATTAAGGTATTTGATAAGGCTTATTCAAAAAATGCAGCTAGCACTAGAGGAATAAGCCATGAAGCATTGAAGATATGAAGAAATGAAGAGTTAACATCCCGAAGGCATCCCATAAGAATTATTCGAAGACATAAACTAAGCACTGGTATAAGACTTTAAGATGTTGCCCATCGAAGCAGTAATAGAAGTGTTTAAGCAGTATACTAAGCACTCGCAGAAGTCATCTGCTAAGCGTTAAACAGCCTAAGTCTTCCGCTAAGGGCTTAAGAAGTGAAGTTCTGAAGAACTTAAGCCCTGACCTAAGACATGAAGATTTTAAGAATTAGGAGAAGCGGTTAAGACATTTAATGGCGAAGAGCTTAAGCGGTTGAACGAAGATCGAAGAGGTAATATAAGAGATTAAGTTGTTTCCTAAAGATCCACAGAAGAGATTAGAGAAGCCGTGAAGAAGTTAAGAACTGAAGAAAAAACTTTCCCAGAAGTCCTGAAGTTCTCGTCTTACGAAGACTTGAAGTAGTAGCCTAAGAACTTAAGCCATTAAGCGATGAAGGTTTCGAAGAAGCAATGAAGAACTGGTCGAAGTGTTAGCAGCCCTAAGACCTCTACTAAGCCATTTAAGCTAGAAGCGGTCGTATGCATAAGCAATGAGCGAAGAGCTGAAGCCGTGAAGCCATCAACGCTAGCTAATGCTAAGACATGAAGCTCTTACATAAGTCGTCAGAACGATAAGATTTTAAGCCGTCGTATTCATAAGTTGTTGAACCTAACACGATATAAGTGATTAAGCTCTGCGAACCCGGCCGCTAGAAGAGCTCTGAGGCATTTAGAACGAAGATATGCACCCACCGAC --> |
| <article id="decoy" class="collapse-h2 collapse-conditional"> | | <article id="decoy" class="collapse-h2 collapse-conditional"> |
| <section> | | <section> |
Line 13: |
Line 14: |
| treatment is applied. </p> | | treatment is applied. </p> |
| | | |
− | <p>We prepared a Bacillus subtilis strain containing a superfolder GFP | + | <p>We prepared a <em>Bacillus subtilis</em> strain containing a superfolder GFP |
| and a spectinomycin resistance cassette in the genome. Then we prepared | | and a spectinomycin resistance cassette in the genome. Then we prepared |
− | mixtures of that mutant with wild-type B. subtilis in different ratios. | + | mixtures of that mutant with wild-type <em>B. subtilis</em> in different ratios. |
| In this experiment living cells were used instead of spores. After | | In this experiment living cells were used instead of spores. After |
| growing in different conditions, the final mixture of mutant vs | | growing in different conditions, the final mixture of mutant vs |
Line 27: |
Line 28: |
| mutant out of 150 wild-type molecules <sup id="#ref-1"><a href="#cite-1">[1]</a></sup><sup id="#ref-2"><a href="#cite-2">[2]</a></sup>. However, fine-tuned | | mutant out of 150 wild-type molecules <sup id="#ref-1"><a href="#cite-1">[1]</a></sup><sup id="#ref-2"><a href="#cite-2">[2]</a></sup>. However, fine-tuned |
| technologies, such as Duplex Sequencing, have shown to increase that | | technologies, such as Duplex Sequencing, have shown to increase that |
− | number to one mutant in 10,000 WT. That same technique is theoretically | + | number to one mutant in 10,000 wild-type cells. That same technique is theoretically |
| able to detect one mutant out of 10 million decoys<sup id="#ref-3"><a href="#cite-3">[3]</a></sup>! </p> | | able to detect one mutant out of 10 million decoys<sup id="#ref-3"><a href="#cite-3">[3]</a></sup>! </p> |
| | | |
Line 39: |
Line 40: |
| <p>We combined different ratios of sfGFP bacteria and decoy bacteria. | | <p>We combined different ratios of sfGFP bacteria and decoy bacteria. |
| LB medium was inoculated from glycerol stocks of the sfGFP strain and | | LB medium was inoculated from glycerol stocks of the sfGFP strain and |
− | the WT strain which were grown overnight at 37 °C, shaking at 220 rpm | + | the wild-type strain which were grown overnight at 37 °C, shaking at 220 rpm |
| in a 3 ml culture. On the next day the corresponding dilutions were | | in a 3 ml culture. On the next day the corresponding dilutions were |
| made and grown again overnight at 37 °C in a shaking liquid 3 ml | | made and grown again overnight at 37 °C in a shaking liquid 3 ml |
Line 76: |
Line 77: |
| <p>The mutant strain containing the superfolder GFP can be seen green | | <p>The mutant strain containing the superfolder GFP can be seen green |
| in the microscopy images and is also marked green in the flow cytometer | | in the microscopy images and is also marked green in the flow cytometer |
− | graphs. The WT decoy cells are gray in both cases.</p> | + | graphs. The wild-type decoy cells are gray in both cases.</p> |
| | | |
− | <!-- | + | <figure> |
| + | <div class="split"> |
| + | <div class="left flone"><img src="" /></div> |
| + | <div class="right flone"><img src="" /></div> |
| + | </div> |
| + | </figure> |
| + | |
| + | <!-- |
| | | |
− | <div class="split">\s*<figure class="left flone">\s*(<img src="[^"]+" \/>)\s*<figcaption>Figure (\d+)[^<]+<\/figcaption>\s*<\/figure>\s*<figure class="right flone">\s*(<img src="[^"]" \/>)\s*<figcaption>Figure (\d+[^<]+)<\/figcaption>\s*<\/figure>\s*<\/div> | + | <div class="split">\s*<figure class="left flone">\s*(<img src="[^"]+" \/>)\s*<figcaption>Figure (\d+)[^<]+<\/figcaption>\s*<\/figure>\s*<figure class="right flone">\s*(<img src="[^"]+" \/>)\s*<figcaption>Figure (\d+[^<]+)<\/figcaption>\s*<\/figure>\s*<\/div> |
| | | |
− | <figure>\n\t\t\t<div class="split">\n\t\t\t\t<div class="left flone">\1</div>\n\t\t\t\t<div class="right flone">\3</div>\n\n\t\t\t<figcaption>Figure \2 & \4</figcaption>\n\t\t</figure> | + | <figure class="centrate">\n\t\t\t<div class="split">\n\t\t\t\t<div class="left flone">\1</div>\n\t\t\t\t<div class="right flone">\3</div>\n\t\t\t</div>\n\t\t\t<figcaption>Figure \2 & \4</figcaption>\n\t\t</figure> |
| | | |
| --> | | --> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d4/T--Groningen--Decoy-2.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d4/T--Groningen--Decoy-2.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/50/T--Groningen--Decoy-3.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/50/T--Groningen--Decoy-3.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 2 & 3: Wildtype without spectinomycin</figcaption> | | <figcaption>Figure 2 & 3: Wildtype without spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/23/T--Groningen--Decoy-4.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/23/T--Groningen--Decoy-4.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/4/41/T--Groningen--Decoy-5.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/4/41/T--Groningen--Decoy-5.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 4 & 5: sfGFP strain without spectinomyin</figcaption> | | <figcaption>Figure 4 & 5: sfGFP strain without spectinomyin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c7/T--Groningen--Decoy-6.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c7/T--Groningen--Decoy-6.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/8/89/T--Groningen--Decoy-7.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/8/89/T--Groningen--Decoy-7.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 6 & 7: Wildtype with spectinomycin</figcaption> | | <figcaption>Figure 6 & 7: Wildtype with spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/f/f4/T--Groningen--Decoy-8.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/f/f4/T--Groningen--Decoy-8.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/c3/T--Groningen--Decoy-9.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/c3/T--Groningen--Decoy-9.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 8 & 9: sfGFP strain with spectinomyin</figcaption> | | <figcaption>Figure 8 & 9: sfGFP strain with spectinomyin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/3/33/T--Groningen--Decoy-10.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/3/33/T--Groningen--Decoy-10.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/cb/T--Groningen--Decoy-11.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/cb/T--Groningen--Decoy-11.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 10 & 11: 1:1 without spectinomycin</figcaption> | | <figcaption>Figure 10 & 11: 1:1 without spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d2/T--Groningen--Decoy-12.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d2/T--Groningen--Decoy-12.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/ca/T--Groningen--Decoy-13.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/c/ca/T--Groningen--Decoy-13.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 12 & 13: 1:1 with spectinomycin</figcaption> | | <figcaption>Figure 12 & 13: 1:1 with spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/0/0f/T--Groningen--Decoy-14.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/0/0f/T--Groningen--Decoy-14.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/1/14/T--Groningen--Decoy-15.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/1/14/T--Groningen--Decoy-15.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 14 & 15: 1:150 without spectinomycin</figcaption> | | <figcaption>Figure 14 & 15: 1:150 without spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/2d/T--Groningen--Decoy-16.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/2d/T--Groningen--Decoy-16.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/a/a2/T--Groningen--Decoy-17.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/a/a2/T--Groningen--Decoy-17.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 16 & 17: 1:150 with spectinomycin</figcaption> | | <figcaption>Figure 16 & 17: 1:150 with spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c8/T--Groningen--Decoy-18.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c8/T--Groningen--Decoy-18.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/56/T--Groningen--Decoy-19.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/56/T--Groningen--Decoy-19.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 18 & 19: 1:10.000.000 without spectinomycin</figcaption> | | <figcaption>Figure 18 & 19: 1:10.000.000 without spectinomycin</figcaption> |
| </figure> | | </figure> |
| | | |
− | <figure> | + | <figure class="centrate"> |
| <div class="split"> | | <div class="split"> |
| <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/e/ed/T--Groningen--Decoy-20.jpg" /></div> | | <div class="left flone"><img src="https://static.igem.org/mediawiki/2016/e/ed/T--Groningen--Decoy-20.jpg" /></div> |
| <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/5c/T--Groningen--Decoy-21.png" /></div> | | <div class="right flone"><img src="https://static.igem.org/mediawiki/2016/5/5c/T--Groningen--Decoy-21.png" /></div> |
− | | + | </div> |
| <figcaption>Figure 20 & 21: 1:10.000.000 with spectinomycin</figcaption> | | <figcaption>Figure 20 & 21: 1:10.000.000 with spectinomycin</figcaption> |
| </figure> | | </figure> |
Line 180: |
Line 188: |
| | | |
| <p>A mixed culture in the ratio 1:1 without the addition of | | <p>A mixed culture in the ratio 1:1 without the addition of |
− | spectinomycin showed presence of both WT and sfGFP cells (Figures 9, | + | spectinomycin showed presence of both wild-type and sfGFP cells (Figures 9, |
| 10, 11 and 12) as expected. However, the unexpected higher ratio of | | 10, 11 and 12) as expected. However, the unexpected higher ratio of |
| sfGFP strain under conditions that do not give advantage over the | | sfGFP strain under conditions that do not give advantage over the |
| wild-type strain leads us to assume that the mutant generally grows | | wild-type strain leads us to assume that the mutant generally grows |
− | faster than the WT strain. Similarly, adding the antibiotic increases | + | faster than the wild-type strain. Similarly, adding the antibiotic increases |
| 20 times the fraction of sfGFP cells, in this case by killing the | | 20 times the fraction of sfGFP cells, in this case by killing the |
− | non-resistant WT.</p> | + | non-resistant wild-type.</p> |
| | | |
| <p>The samples with a 1:150 ratio showed consistent results (Figures | | <p>The samples with a 1:150 ratio showed consistent results (Figures |
Line 193: |
Line 201: |
| though the initial ratio was not in its favor (1:150). </p> | | though the initial ratio was not in its favor (1:150). </p> |
| | | |
− | <p>We went to an extreme of using a ratio of 1 mutant in 10 million WT. | + | <p>We went to an extreme of using a ratio of 1 mutant in 10 million wild-type cells. |
| In this conditions, no growth of mutants was observed. The ratio is too | | In this conditions, no growth of mutants was observed. The ratio is too |
| high to allow the mutant strain to grow even in the presence of | | high to allow the mutant strain to grow even in the presence of |
− | antibiotic that would give it an advantage over the WT.</p> | + | antibiotic that would give it an advantage over the wild-type strain.</p> |
| </section> | | </section> |
| <section> | | <section> |