Difference between revisions of "Template:Groningen/Decoy"

 
(2 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
<html>
 
<html>
 +
<!-- GACCAAGCCTGCAAAATCAAACCACTAATAAGAGGAGAAGCGCTGAAAATTCGAAGTTCTTAAGAACTTCTCCGTCATCCCTACGACAGAAGTTTTGAAGTCCTACAAGATCGAAGAATTTAAGAAAAAACTTTTAAGCCGTTCGATGCCTAAGCACTGAAGCCCTAAGCTCCCTAAGCCTTTAAGAGCTGAAGGCTTCTCAACGATTAACAGCTAAGCCTTTAAGATGTCAAATCACCAGCAGGCGAAGGGATGACCACCAGATAAAAAACTATCGAAGAATTTAAGGCCTAGGAGAAGCGTTTGCATAAGCGATGAAGTCATGCGAATAAAAAATCTGCACAACACCCTAAGTAATTTCCTAAGTATTTAAGTGATCGACGACATAAGGAGTTAAGTACTAGCCGAAGGTATTTGAGAAGTCGTAATCGAAGTATTGATCGAAGTAATGAAGAGCTTAAGCACTTAAGGAGTGAAGCGGTACCAGTTAGGGCGAAGCCGTTGGCACTCTAAGCGATGTTATCGATAAGGGCTGCAATTACCTGCTAAGAGTTTAACGAAGGTTTAGGCGAAGTCATTAAGCCATTAACGAAGTTATTGCATATCTAAGAAGTTAAGGCCTGTTCGAAGTTATGAAGCGCTCTAATAAGAACTCGAAGAAGAGCTATTCGAAGTGGTGTTATACATAAGGCGTGAAGGGCTTAACAGCATAAGTAGTGAGAGAAGTGTTGAGCTAAGCTATGAAGAAGTGAGCCATAGGTATACCTACCCGGAGAAGATGTTTTCGAAGTTGTGAAGGACTTAAGGACTTGACACAAGAAGCCTTGAAGCCATGGGCGAAGGTATGAAGACCTGAAGAGTTATCCTAAGCTGTGGCAGTGAGAAGCAGTAGACTCTATTCACCACAGCAGAAGTCGTCCCCATGACTCAGAGCTAAGAAAAAACTTTGACATAAGTATTTCTCTAAGGCGTTAAAAACCTAAGGGCTCTTAGAAGTCGTGAAGAGGTGAAGCGATTAAGCGGTGAAGAGGTCGGAGCTCTAAGTTGTTAAGCGCTTGTCGAAGAACTGAAGGCCTATTAAAACAGGCTAAGCTCTGCCAGAAGTTCTGAAGAGGTTAAGCTGTTAAGACATGAAGCGATTAGATAAGTTCTTCTCGAAGGATTCCCATAAGTACTGAAGCCGTTAAGGGATTAAGAATTATACATCCTAAGGGGTGAAGCTATGATCTTAAGAAGCCATGAAGCGCTGTACTAAGAGCTGGGCCAAACATCGAAGCGCTCGCCTAAGGATTCACAAAACTAAGTGGTTAAGTCTTGGGCTAAGGTGTGGAACAAAGAAGTGGTGAAGACGTGTTATCGAACACTAAGCTGTGAAGCAATAATCTAAGAAATTAAGGTATGAAGGACTCAACGAAGGACTGAAGCGTTTGCCGAAGAAATTAAGGCCTCGCAGAAGCATTTAAGAACTGAAGTTATATTCCCAAGAAGAGTTGAAGATGTTAAGCAGTGTCAACTCCCCAAAGAATACGAAGGGTTTTCCAGGCATTATCCAGAAGTCATTAAGGTATTTGATAAGGCTTATTCAAAAAATGCAGCTAGCACTAGAGGAATAAGCCATGAAGCATTGAAGATATGAAGAAATGAAGAGTTAACATCCCGAAGGCATCCCATAAGAATTATTCGAAGACATAAACTAAGCACTGGTATAAGACTTTAAGATGTTGCCCATCGAAGCAGTAATAGAAGTGTTTAAGCAGTATACTAAGCACTCGCAGAAGTCATCTGCTAAGCGTTAAACAGCCTAAGTCTTCCGCTAAGGGCTTAAGAAGTGAAGTTCTGAAGAACTTAAGCCCTGACCTAAGACATGAAGATTTTAAGAATTAGGAGAAGCGGTTAAGACATTTAATGGCGAAGAGCTTAAGCGGTTGAACGAAGATCGAAGAGGTAATATAAGAGATTAAGTTGTTTCCTAAAGATCCACAGAAGAGATTAGAGAAGCCGTGAAGAAGTTAAGAACTGAAGAAAAAACTTTCCCAGAAGTCCTGAAGTTCTCGTCTTACGAAGACTTGAAGTAGTAGCCTAAGAACTTAAGCCATTAAGCGATGAAGGTTTCGAAGAAGCAATGAAGAACTGGTCGAAGTGTTAGCAGCCCTAAGACCTCTACTAAGCCATTTAAGCTAGAAGCGGTCGTATGCATAAGCAATGAGCGAAGAGCTGAAGCCGTGAAGCCATCAACGCTAGCTAATGCTAAGACATGAAGCTCTTACATAAGTCGTCAGAACGATAAGATTTTAAGCCGTCGTATTCATAAGTTGTTGAACCTAACACGATATAAGTGATTAAGCTCTGCGAACCCGGCCGCTAGAAGAGCTCTGAGGCATTTAGAACGAAGATATGCACCCACCGAC -->
 
<article id="decoy" class="collapse-h2 collapse-conditional">
 
<article id="decoy" class="collapse-h2 collapse-conditional">
 
<section>
 
<section>
Line 13: Line 14:
 
treatment is applied. </p>
 
treatment is applied. </p>
  
<p>We prepared a Bacillus subtilis strain containing a superfolder GFP  
+
<p>We prepared a <em>Bacillus subtilis</em> strain containing a superfolder GFP  
 
and a spectinomycin resistance cassette in the genome. Then we prepared  
 
and a spectinomycin resistance cassette in the genome. Then we prepared  
mixtures of that mutant with wild-type B. subtilis in different ratios.  
+
mixtures of that mutant with wild-type <em>B. subtilis</em> in different ratios.  
 
In this experiment living cells were used instead of spores. After  
 
In this experiment living cells were used instead of spores. After  
 
growing in different conditions, the final mixture of mutant vs  
 
growing in different conditions, the final mixture of mutant vs  
Line 27: Line 28:
 
mutant out of 150 wild-type molecules <sup id="#ref-1"><a href="#cite-1">[1]</a></sup><sup id="#ref-2"><a href="#cite-2">[2]</a></sup>. However, fine-tuned  
 
mutant out of 150 wild-type molecules <sup id="#ref-1"><a href="#cite-1">[1]</a></sup><sup id="#ref-2"><a href="#cite-2">[2]</a></sup>. However, fine-tuned  
 
technologies, such as Duplex Sequencing, have shown to increase that  
 
technologies, such as Duplex Sequencing, have shown to increase that  
number to one mutant in 10,000 WT. That same technique is theoretically  
+
number to one mutant in 10,000 wild-type cells. That same technique is theoretically  
 
able to detect one mutant out of 10 million decoys<sup id="#ref-3"><a href="#cite-3">[3]</a></sup>! </p>
 
able to detect one mutant out of 10 million decoys<sup id="#ref-3"><a href="#cite-3">[3]</a></sup>! </p>
 
 
Line 39: Line 40:
 
<p>We combined different ratios of sfGFP bacteria and decoy bacteria.  
 
<p>We combined different ratios of sfGFP bacteria and decoy bacteria.  
 
LB medium was inoculated from glycerol stocks of the sfGFP strain and  
 
LB medium was inoculated from glycerol stocks of the sfGFP strain and  
the WT strain which were grown overnight at 37 °C, shaking at 220 rpm  
+
the wild-type strain which were grown overnight at 37 °C, shaking at 220 rpm  
 
in a 3 ml culture. On the next day the corresponding dilutions were  
 
in a 3 ml culture. On the next day the corresponding dilutions were  
 
made and grown again overnight at 37 °C in a shaking liquid 3 ml  
 
made and grown again overnight at 37 °C in a shaking liquid 3 ml  
Line 76: Line 77:
 
<p>The mutant strain containing the superfolder GFP can be seen green  
 
<p>The mutant strain containing the superfolder GFP can be seen green  
 
in the microscopy images and is also marked green in the flow cytometer  
 
in the microscopy images and is also marked green in the flow cytometer  
graphs. The WT decoy cells are gray in both cases.</p>
+
graphs. The wild-type decoy cells are gray in both cases.</p>
 
 
 
<figure>
 
<figure>
Line 85: Line 86:
 
</figure>
 
</figure>
 
 
<figure>
+
<!--
 +
 +
<div class="split">\s*<figure class="left flone">\s*(<img src="[^"]+" \/>)\s*<figcaption>Figure (\d+)[^<]+<\/figcaption>\s*<\/figure>\s*<figure class="right flone">\s*(<img src="[^"]+" \/>)\s*<figcaption>Figure (\d+[^<]+)<\/figcaption>\s*<\/figure>\s*<\/div>
 +
 +
<figure class="centrate">\n\t\t\t<div class="split">\n\t\t\t\t<div class="left flone">\1</div>\n\t\t\t\t<div class="right flone">\3</div>\n\t\t\t</div>\n\t\t\t<figcaption>Figure \2 &amp; \4</figcaption>\n\t\t</figure>
 +
 +
-->
 +
 +
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d4/T--Groningen--Decoy-2.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d4/T--Groningen--Decoy-2.jpg" /></div>
Line 93: Line 102:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/23/T--Groningen--Decoy-4.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/23/T--Groningen--Decoy-4.jpg" /></div>
Line 101: Line 110:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c7/T--Groningen--Decoy-6.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c7/T--Groningen--Decoy-6.jpg" /></div>
Line 109: Line 118:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/f/f4/T--Groningen--Decoy-8.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/f/f4/T--Groningen--Decoy-8.jpg" /></div>
Line 117: Line 126:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/3/33/T--Groningen--Decoy-10.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/3/33/T--Groningen--Decoy-10.jpg" /></div>
Line 125: Line 134:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d2/T--Groningen--Decoy-12.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/d/d2/T--Groningen--Decoy-12.jpg" /></div>
Line 133: Line 142:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/0/0f/T--Groningen--Decoy-14.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/0/0f/T--Groningen--Decoy-14.jpg" /></div>
Line 141: Line 150:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/2d/T--Groningen--Decoy-16.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/2/2d/T--Groningen--Decoy-16.jpg" /></div>
Line 149: Line 158:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c8/T--Groningen--Decoy-18.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/c/c8/T--Groningen--Decoy-18.jpg" /></div>
Line 157: Line 166:
 
</figure>
 
</figure>
 
 
<figure>
+
<figure class="centrate">
 
<div class="split">
 
<div class="split">
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/e/ed/T--Groningen--Decoy-20.jpg" /></div>
 
<div class="left flone"><img src="https://static.igem.org/mediawiki/2016/e/ed/T--Groningen--Decoy-20.jpg" /></div>
Line 179: Line 188:
  
 
<p>A mixed culture in the ratio 1:1 without the addition of  
 
<p>A mixed culture in the ratio 1:1 without the addition of  
spectinomycin showed presence of both WT and sfGFP cells (Figures 9,  
+
spectinomycin showed presence of both wild-type and sfGFP cells (Figures 9,  
 
10, 11 and 12) as expected. However, the unexpected higher ratio of  
 
10, 11 and 12) as expected. However, the unexpected higher ratio of  
 
sfGFP strain under conditions that do not give advantage over the  
 
sfGFP strain under conditions that do not give advantage over the  
 
wild-type strain leads us to assume that the mutant generally grows  
 
wild-type strain leads us to assume that the mutant generally grows  
faster than the WT strain. Similarly, adding the antibiotic increases  
+
faster than the wild-type strain. Similarly, adding the antibiotic increases  
 
20 times the fraction of sfGFP cells, in this case by killing the  
 
20 times the fraction of sfGFP cells, in this case by killing the  
non-resistant WT.</p>
+
non-resistant wild-type.</p>
 
 
 
<p>The samples with a 1:150 ratio showed consistent results (Figures  
 
<p>The samples with a 1:150 ratio showed consistent results (Figures  
Line 192: Line 201:
 
though the initial ratio was not in its favor (1:150). </p>
 
though the initial ratio was not in its favor (1:150). </p>
 
 
<p>We went to an extreme of using a ratio of 1 mutant in 10 million WT.  
+
<p>We went to an extreme of using a ratio of 1 mutant in 10 million wild-type cells.  
 
In this conditions, no growth of mutants was observed. The ratio is too  
 
In this conditions, no growth of mutants was observed. The ratio is too  
 
high to allow the mutant strain to grow even in the presence of  
 
high to allow the mutant strain to grow even in the presence of  
antibiotic that would give it an advantage over the WT.</p>
+
antibiotic that would give it an advantage over the wild-type strain.</p>
 
</section>
 
</section>
 
<section>
 
<section>

Latest revision as of 21:21, 4 January 2017

Decoy

The spores containing the DNA sequence that encodes our key will be sent in a mixture with decoy spores. These strains were constructed with our BioBricks BBa_K1930002 (key) and BBa_K1930006 (sfGFP) The high ratio of decoy spores makes it hard for unauthorized parties to retrieve the correct key if they try to sequence the entire sample by brute force. In this experiment we tried to determine how fine our system is in selecting the spores from the decoy once the right treatment is applied.

We prepared a Bacillus subtilis strain containing a superfolder GFP and a spectinomycin resistance cassette in the genome. Then we prepared mixtures of that mutant with wild-type B. subtilis in different ratios. In this experiment living cells were used instead of spores. After growing in different conditions, the final mixture of mutant vs wild-type strains was determined microscopically and in a flow cytometer.

Due to the high ratio of decoy cells, any non-approved party trying to sequence the entire sample will not be able to distinguish the key-sequence from the background noise. In the scientific literature, using standard sequencing techniques it has been possible to detect one mutant out of 150 wild-type molecules [1][2]. However, fine-tuned technologies, such as Duplex Sequencing, have shown to increase that number to one mutant in 10,000 wild-type cells. That same technique is theoretically able to detect one mutant out of 10 million decoys[3]!

Experiment setup

We combined different ratios of sfGFP bacteria and decoy bacteria. LB medium was inoculated from glycerol stocks of the sfGFP strain and the wild-type strain which were grown overnight at 37 °C, shaking at 220 rpm in a 3 ml culture. On the next day the corresponding dilutions were made and grown again overnight at 37 °C in a shaking liquid 3 ml culture. The antibiotic was added to both the preculture and the diluted culture.

The next morning the cells were visualized in the microscope Time-lapse microscopy/Phase-contrast microscopy and additionally diluted 50 times in 1X PBS buffer to analyze in the flow cytometer.

Figure no.Concentration spectinomycin [µg/ml]Initial ratio sfGFP:decoyFinal ratio sfGFP:decoy
1,200:10:1
3,401:025:1
5,61500:10:1
7,81501:0160:1
9,1001:112:1
11,121501:1230:1
13,1401:15010:1
15,161501:15070:1
17,1801:10,000,0000:1
19,201501:10,000,0000:1
Table 1. The initial ratio of mutant vs wild-type strains was screened from 1 to 10 million. The final ratio was measured as the relative (green:gray) area under the curve (AUC) obtained in the flow cytometer (Figures 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20). [Using: Flowing Software 2.5]

Results

The mutant strain containing the superfolder GFP can be seen green in the microscopy images and is also marked green in the flow cytometer graphs. The wild-type decoy cells are gray in both cases.

Figure 2 & 3: Wildtype without spectinomycin
Figure 4 & 5: sfGFP strain without spectinomyin
Figure 6 & 7: Wildtype with spectinomycin
Figure 8 & 9: sfGFP strain with spectinomyin
Figure 10 & 11: 1:1 without spectinomycin
Figure 12 & 13: 1:1 with spectinomycin
Figure 14 & 15: 1:150 without spectinomycin
Figure 16 & 17: 1:150 with spectinomycin
Figure 18 & 19: 1:10.000.000 without spectinomycin
Figure 20 & 21: 1:10.000.000 with spectinomycin

Discussion

As control groups we used samples that contained either only the decoy wild-type strain or the spectinomycin-resistant sfGFP mutant. While the wild type grew well without addition of spectinomycin (Figures 1 and 2), no growth could be observed if the antibiotic was added (Figures 5 and 6). On the other hand, the spectinomycin resistant sfGFP strain grew well both in its presence or absence (Figures 3, 4, 7 and 8). In both cases, growth of cells not expressing sfGFP was observed. This could be due to not fully developed cells that do not yet express sfGFP in their current cell cycle.

A mixed culture in the ratio 1:1 without the addition of spectinomycin showed presence of both wild-type and sfGFP cells (Figures 9, 10, 11 and 12) as expected. However, the unexpected higher ratio of sfGFP strain under conditions that do not give advantage over the wild-type strain leads us to assume that the mutant generally grows faster than the wild-type strain. Similarly, adding the antibiotic increases 20 times the fraction of sfGFP cells, in this case by killing the non-resistant wild-type.

The samples with a 1:150 ratio showed consistent results (Figures 13, 14, 15 and 16) compared to the 1:1 ratios. Without the addition of spectinomycin the mutant outgrew the wild-type strain (10:1) even though the initial ratio was not in its favor (1:150).

We went to an extreme of using a ratio of 1 mutant in 10 million wild-type cells. In this conditions, no growth of mutants was observed. The ratio is too high to allow the mutant strain to grow even in the presence of antibiotic that would give it an advantage over the wild-type strain.

Conclusion

Our experiment shows that a specific strain, in this case containing a sfGFP and a spectinomycin resistance cassette can be selected from a larger number of decoys. We could not determine the optimal ratio that would strengthen this layer of biosecurity. For further experiments the ratio of decoys should be fine tuned to determine the maximum ratio of spores:decoys that could be used, thus reassuring that unauthorized parties will not be able to recover the key by sequencing the whole sample but the intended recipient will still be able to recover it.

References:
  • [1]Fox EJ, Reid-Bayliss KS, Emond MJ, Loeb LA (2014) Accuracy of Next Generation Sequencing Platforms. Next Generat Sequenc & Applic 1: 106. doi:10.4172/jngsa.1000106
  • [2]Pochon (2013). Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests. PLos One 8(9):e73935
  • [3]Schmitt MW, Kennedy SR, Salk JJ, Fox EJ, Hiatt JB, et al. (2012) Detection of ultra-rare mutations by next-generation sequencing. Proc Natl Acad Sci U S A 109: 14508-14513.