(→gBlock plasmid insertion) |
|||
Line 1: | Line 1: | ||
− | + | =Antibiotics concentrations= | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
The following concentrations of antibiotic were used to grow bacteria (on Petri dishes or liquid cultures): | The following concentrations of antibiotic were used to grow bacteria (on Petri dishes or liquid cultures): | ||
Line 34: | Line 23: | ||
|} | |} | ||
− | + | =Cloning PCR Products= | |
<div id="Cloning PCR products"></div> | <div id="Cloning PCR products"></div> | ||
==== Ligation with pJET 1.2/blunt vector==== | ==== Ligation with pJET 1.2/blunt vector==== | ||
Line 68: | Line 57: | ||
#The ligation mixture can be used directly for transformation. (Note. Keep the ligation mix at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation). | #The ligation mixture can be used directly for transformation. (Note. Keep the ligation mix at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation). | ||
− | + | =Heat shock competent cells= | |
<div id="HeatShockCompetent"></div> | <div id="HeatShockCompetent"></div> | ||
− | + | ==Preparation== | |
'''Day 1''' Inoculate cells in 3.5mL LB medium. | '''Day 1''' Inoculate cells in 3.5mL LB medium. | ||
Incubate at 37°C overnight. | Incubate at 37°C overnight. | ||
Line 107: | Line 96: | ||
Dissolve HEPES, CaCl<sub>2</sub> and KCl in water. Adjust pH to 6.7 with KOH. Add MnCl<sub>2</sub>. Filter to sterilize and keep at 4°C. | Dissolve HEPES, CaCl<sub>2</sub> and KCl in water. Adjust pH to 6.7 with KOH. Add MnCl<sub>2</sub>. Filter to sterilize and keep at 4°C. | ||
− | + | ==Transformation<div id="heat-shocktransformation"></div>== | |
Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). | Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). | ||
Keep tubes on ice for 30min and heat shock at 42°C for 1min. | Keep tubes on ice for 30min and heat shock at 42°C for 1min. | ||
Line 113: | Line 102: | ||
Spread cells on Petri dishes in duplicate and incubate at 37°C overnight. | Spread cells on Petri dishes in duplicate and incubate at 37°C overnight. | ||
− | + | =Electro-competent cells= | |
<div id="ElectroCompetent"></div> | <div id="ElectroCompetent"></div> | ||
− | + | ==Preparation== | |
Inoculate 15mL of LB with 200µL of an overnight cell culture. | Inoculate 15mL of LB with 200µL of an overnight cell culture. | ||
Incubate at 37°C and 180rpm until OD<sub>600nm</sub> reaches 0.6. | Incubate at 37°C and 180rpm until OD<sub>600nm</sub> reaches 0.6. | ||
Line 122: | Line 111: | ||
Put cells in 200µL of 10% glycerol and use for electroporation. | Put cells in 200µL of 10% glycerol and use for electroporation. | ||
− | + | ==Transformation== | |
Use an Eppendorf Electroporator 2510 (tune to 2500V). | Use an Eppendorf Electroporator 2510 (tune to 2500V). | ||
Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). | Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). | ||
Line 129: | Line 118: | ||
Spread cells on Petri dishes in two different concentrations and incubate at 37°C overnight. | Spread cells on Petri dishes in two different concentrations and incubate at 37°C overnight. | ||
− | + | =Plasmid DNA extraction= | |
<div id="PlasmidExtraction"></div> | <div id="PlasmidExtraction"></div> | ||
Transfer 1.5mL of an overnight culture into an eppendorf tube. | Transfer 1.5mL of an overnight culture into an eppendorf tube. | ||
Line 196: | Line 185: | ||
|} | |} | ||
− | + | =DNA extraction using the Invitrogen ChargeSwitch®-Pro Plasmid Miniprep Kit= | |
<div id="InvitrogenPlasmidExtraction"></div> | <div id="InvitrogenPlasmidExtraction"></div> | ||
Follow the steps below to purify plasmid DNA from 1-5ml of fresh overnight cultures using a microcentrifuge. All steps are performed at room temperature. | Follow the steps below to purify plasmid DNA from 1-5ml of fresh overnight cultures using a microcentrifuge. All steps are performed at room temperature. | ||
− | + | ==Before Starting== | |
*For a new kit, add Rnase A (provided in the kit) to the Resuspension Buffer and mix. | *For a new kit, add Rnase A (provided in the kit) to the Resuspension Buffer and mix. | ||
*If necessary, warm the Lysis Buffer to 37°C to dissolve any precipitate. | *If necessary, warm the Lysis Buffer to 37°C to dissolve any precipitate. | ||
− | + | ==Preparing the Sample== | |
#Pellet cells from 1-5 ml of overnight culture. | #Pellet cells from 1-5 ml of overnight culture. | ||
#Resuspend in 250 µL of Resuspension Buffer premixed with Rnase A. No cell clumps should remain. | #Resuspend in 250 µL of Resuspension Buffer premixed with Rnase A. No cell clumps should remain. | ||
Line 212: | Line 201: | ||
#Centrifuge for 10 minutes at maximum speed to pellet the debris. | #Centrifuge for 10 minutes at maximum speed to pellet the debris. | ||
− | + | ==Binding the DNA== | |
#Carefully transfer the supernatant from Step 2.6 above onto the ChargeSwitch®-Pro MiniPrep Colum inserted in a Collection Tube. | #Carefully transfer the supernatant from Step 2.6 above onto the ChargeSwitch®-Pro MiniPrep Colum inserted in a Collection Tube. | ||
#Centrifuge the column/tube at maximun speed for 30-60 seconds. | #Centrifuge the column/tube at maximun speed for 30-60 seconds. | ||
#Remove the column from the tube and discard the flow-through. Re-insert the column in the same tube. | #Remove the column from the tube and discard the flow-through. Re-insert the column in the same tube. | ||
− | + | ==Washing the Column== | |
#Add 750µL of Wash Buffer 1 to the column. | #Add 750µL of Wash Buffer 1 to the column. | ||
#Centrifuge the column/tube at the maximun speed for 30-60 seconds. | #Centrifuge the column/tube at the maximun speed for 30-60 seconds. | ||
Line 225: | Line 214: | ||
#remove the column from the tube. Discard the flow-through and the Collection Tube. | #remove the column from the tube. Discard the flow-through and the Collection Tube. | ||
− | + | ==Eluting the DNA== | |
#Insert the column into an Elution Tube (provided in the kit). | #Insert the column into an Elution Tube (provided in the kit). | ||
#Add 50-100µL of Elution Buffer onto the column. | #Add 50-100µL of Elution Buffer onto the column. | ||
Line 232: | Line 221: | ||
#The eluate contains your purified plasmid DNA. Store DNA at 4°C or -20°C. | #The eluate contains your purified plasmid DNA. Store DNA at 4°C or -20°C. | ||
− | + | =Plasmid digestion= | |
<div id="PlasmidDigestion"></div> | <div id="PlasmidDigestion"></div> | ||
Mix 10µL of extracted plasmid with 2µL of digestion buffer and 7µL of water. | Mix 10µL of extracted plasmid with 2µL of digestion buffer and 7µL of water. | ||
Line 239: | Line 228: | ||
Then digestion products are migrated on [[#Electrophoresis|an agarose gel]]. | Then digestion products are migrated on [[#Electrophoresis|an agarose gel]]. | ||
− | + | =gBlock plasmid insertion= | |
<div id="Ligation"></div> | <div id="Ligation"></div> | ||
The following ratio should be over 7: | The following ratio should be over 7: | ||
Line 252: | Line 241: | ||
Incubate for 1h at RT. | Incubate for 1h at RT. | ||
− | + | =List of plasmids constructed= | |
<div id="pPS16_001"></div> | <div id="pPS16_001"></div> | ||
Line 407: | Line 396: | ||
|} | |} | ||
− | + | =DNA electrophoresis on agarose gel= | |
<div id="Electrophoresis"></div> | <div id="Electrophoresis"></div> | ||
− | + | ==Gel preparation== | |
Mix agarose and TAE buffer to get a final concentration of 0.8%(w/v). | Mix agarose and TAE buffer to get a final concentration of 0.8%(w/v). | ||
Microwave for 1-2min in order to melt the agarose. | Microwave for 1-2min in order to melt the agarose. | ||
Line 420: | Line 409: | ||
Visualize DNA fragments with UV light. | Visualize DNA fragments with UV light. | ||
+ | =Polymerase chain reaction= | ||
− | + | ==List of PCR primers== | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div id="primers"></div> | <div id="primers"></div> | ||
Line 711: | Line 697: | ||
|} | |} | ||
− | + | ==PCR with Taq PCRx DNA Polymerase (recombinant) or DreamTaq DNA Polymerase from ThermoFisher Scientific== | |
<div id="taqPCR"></div> | <div id="taqPCR"></div> | ||
*Prepare enough PCR master mix for the number of colonies analyzed plus one extra. Mix the following reagents : | *Prepare enough PCR master mix for the number of colonies analyzed plus one extra. Mix the following reagents : | ||
Line 801: | Line 787: | ||
*[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. | *[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. | ||
− | + | ==PCR with Q5<sup>®</sup> High-Fidelity 2X Master Mix from NEB== | |
<div id="Q5PCR"></div> | <div id="Q5PCR"></div> | ||
*Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 25μl of reaction, mix the following reagents : | *Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 25μl of reaction, mix the following reagents : | ||
Line 923: | Line 909: | ||
*[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. | *[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. | ||
− | + | = Purification : PCR clean-up with NucleoSpin Gel and PCR Clean-up = | |
<div id="Purification"></div> | <div id="Purification"></div> | ||
− | + | ||
+ | ==Adjuste DNA binding condition== | ||
PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1. | PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1. | ||
− | == | + | ==Binding the DNA== |
NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube. | NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube. | ||
− | + | ==Wash silica membrane== | |
700µL of Buffer NT3 is added in each column. The tubes were centrifuged at 11,000 rpm for 30s. The flow-through is discarded and the column put back into the collection tube. This step is repeated another time. | 700µL of Buffer NT3 is added in each column. The tubes were centrifuged at 11,000 rpm for 30s. The flow-through is discarded and the column put back into the collection tube. This step is repeated another time. | ||
− | + | ==Dry silica membrane== | |
The tubes were centrifuged 1min at 11,000 rpm to removed completely. | The tubes were centrifuged 1min at 11,000 rpm to removed completely. | ||
− | + | ==Elute DNA== | |
The NuleoSpin gel and PCR clean-up column were put into new tube (1.5mL) and 30*L of Buffer NE was added. The tube were left incubated for 1 at RT and then centrifuged 1min at 11,000 rpm. | The NuleoSpin gel and PCR clean-up column were put into new tube (1.5mL) and 30*L of Buffer NE was added. The tube were left incubated for 1 at RT and then centrifuged 1min at 11,000 rpm. | ||
Line 959: | Line 946: | ||
Incubate sample for 5-1à min at 50°C. Vortex the sample briefly every 2-3 min until the gel slice is completely dissolved! | Incubate sample for 5-1à min at 50°C. Vortex the sample briefly every 2-3 min until the gel slice is completely dissolved! | ||
− | + | ==Bind DNA== | |
Place a NucleoSPin Gel and PCR Clean-Up COlumn into a Collection Tube (2mL) and load up to 700µL sample. | Place a NucleoSPin Gel and PCR Clean-Up COlumn into a Collection Tube (2mL) and load up to 700µL sample. | ||
Centrifuge for 30s at 11 000x g. Discard flow-through and place the column nack into the collection tube. | Centrifuge for 30s at 11 000x g. Discard flow-through and place the column nack into the collection tube. | ||
− | |||
PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1. | PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1. | ||
− | + | ==Bind DNA== | |
NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube. | NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube. | ||
Line 974: | Line 960: | ||
Load remaining sample if necessary and repeat the centrifugation step. | Load remaining sample if necessary and repeat the centrifugation step. | ||
− | + | ==Wash silica membrane== | |
Add 700µL Buffer NT3 to the NucleoSpin Gel and PCR Clean-up Column. Centrifuge for 30s at 11 000 x g. Discard flow-through and place the column back into the collection tube. | Add 700µL Buffer NT3 to the NucleoSpin Gel and PCR Clean-up Column. Centrifuge for 30s at 11 000 x g. Discard flow-through and place the column back into the collection tube. | ||
Line 980: | Line 966: | ||
Recommended: Repeat previous washing step to minimize chaotropic salt carry-over and low A260/A260. | Recommended: Repeat previous washing step to minimize chaotropic salt carry-over and low A260/A260. | ||
− | + | ==Dry silica membrane== | |
Centrifuge for 1 min at 1 000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube. | Centrifuge for 1 min at 1 000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube. | ||
− | + | ==Elute DNA== | |
Place the NucleoSpin Gel and PCR Clean-up Column into a new 1.5mL microcentrifuge tube. | Place the NucleoSpin Gel and PCR Clean-up Column into a new 1.5mL microcentrifuge tube. | ||
Add 15-30µL Buffer NE and incubate at room temperature (18-25°C) for 1 min. Centrifuge for 1 min at 11 000 x g. | Add 15-30µL Buffer NE and incubate at room temperature (18-25°C) for 1 min. Centrifuge for 1 min at 11 000 x g. | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
*[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. | *[[#Electrophoresis|Analyze on a gel]] for the presence of the PCR product of the expected length. |
Revision as of 12:49, 22 September 2016
Contents
- 1 Antibiotics concentrations
- 2 Cloning PCR Products
- 3 Heat shock competent cells
- 4 Electro-competent cells
- 5 Plasmid DNA extraction
- 6 DNA extraction using the Invitrogen ChargeSwitch®-Pro Plasmid Miniprep Kit
- 7 Plasmid digestion
- 8 gBlock plasmid insertion
- 9 List of plasmids constructed
- 10 DNA electrophoresis on agarose gel
- 11 Polymerase chain reaction
- 12 Purification : PCR clean-up with NucleoSpin Gel and PCR Clean-up
Antibiotics concentrations
The following concentrations of antibiotic were used to grow bacteria (on Petri dishes or liquid cultures):
Antibiotic | Concentration (µg/mL) |
---|---|
Ampicillin | 50 |
Chloramphenicol | 30 |
Kanamycin | 50 |
Spectinomycin | 50 |
Streptomycin | 50 |
Cloning PCR Products
Ligation with pJET 1.2/blunt vector
Component | Volume (µL) |
---|---|
2x Reaction Buffer | 10 |
PCR product | 1 |
pJET 1.2/blunt cloning vector | 1 |
T4 DNA Ligase | 1 |
Nuclease-free water | up to 19 |
Total Volume | 20 |
- Vortex the ligation mixture.
- Short spin (3- 5 seconds) of the same tube.
- Incubation of the ligation at RT for 5 minutes. (Note. For PCR products > 3kb, ligation can be prolonged to 30 min)
- The ligation mixture can be used directly for transformation. (Note. Keep the ligation mix at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation).
Heat shock competent cells
Preparation
Day 1 Inoculate cells in 3.5mL LB medium. Incubate at 37°C overnight.
Day 2 Measure culture OD at 600nm. Dilute cells in 250mL of LB medium so OD equals to 0.12. Incubate overnight at 20°C and 180rpm.
Day 3 Measure culture OD at 600nm and dilute to obtain OD600nm=0.6. Cells must be kept at 4°C during all following steps. Put on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant and resuspend cells in 80mL of fresh TB buffer. Keep on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant again and resuspend cells in 20mL of fresh TB buffer with 7% of DMSO. Keep on ice for 10min. Aliquot cells and freeze with liquid nitrogen. Keep at -80°C.
TB buffer recipe
HEPES | 10mM |
MnCl2 | 55mM |
CaCl2 | 15mM |
KCl | 250mM |
KOH | up to pH6.7 |
Dissolve HEPES, CaCl2 and KCl in water. Adjust pH to 6.7 with KOH. Add MnCl2. Filter to sterilize and keep at 4°C.
Transformation
Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Keep tubes on ice for 30min and heat shock at 42°C for 1min. Add 500µL of LB medium into each tube and incubate at 37°C for 1h. Spread cells on Petri dishes in duplicate and incubate at 37°C overnight.
Electro-competent cells
Preparation
Inoculate 15mL of LB with 200µL of an overnight cell culture. Incubate at 37°C and 180rpm until OD600nm reaches 0.6. Centrifuge cells for 10 minutes at 4000rpm. Wash twice with 10mL of 10% glycerol. Put cells in 200µL of 10% glycerol and use for electroporation.
Transformation
Use an Eppendorf Electroporator 2510 (tune to 2500V). Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Place cells in a 1mm-cuvette, electroporate (the time constant should be close to 6ms) and recover cells with 1mL of cold LB medium. Incubate cells for 1h at 37°C. Spread cells on Petri dishes in two different concentrations and incubate at 37°C overnight.
Plasmid DNA extraction
Transfer 1.5mL of an overnight culture into an eppendorf tube. Centrifuge at 13000rpm for 1min to pellet the cells. Discard supernatant and resuspend cells in 100µL of TE buffer. Add 200µL of solution II and mix gently by inverting the tubes until lysate appears clear. Add 150µL of solution III and mixed gently. Keep the solution on ice for 10min. Centrifuge for 10min at 13000rpm and recover the supernatant. Add 100µL of phenol in each tubes to denature the proteins and vortex for 30s. Centrifuge the tubes for 7min at 13000rpm. Recover the aqueous phase. Add 2 volumes (900µL) of 100% ethanol and put at -20°C for 10min. Centrifuge the tubes again for 10min at 13000rpm. Discard supernatant and wash with 800µL of 70% ethanol to remove the remaining ions. Make sure that the pellet containing DNA remains at the bottom of the tubes. Centrifuge the tubes for 4min at 13000rpm and remove supernatants. Dry tubes in speedvac. Resuspend the pellet in 50µL of TE/RNAse. Keep the extracted plasmids at -20°C.
TE buffer recipeTris | 10mM |
EDTA | 55mM |
SDS | 1% |
NaOH | 0.1M |
Solution III recipe (neutralization solution) CH3COOK 3M at pH4.8.
CH3COOK 5M | 60mL |
CH3COOH | 11.5mL |
water | 28.5mL |
TE/RNase Use only fresh solution.
RNase (10mg/mL) | 5µL |
TE | 1mL |
DNA extraction using the Invitrogen ChargeSwitch®-Pro Plasmid Miniprep Kit
Follow the steps below to purify plasmid DNA from 1-5ml of fresh overnight cultures using a microcentrifuge. All steps are performed at room temperature.
Before Starting
- For a new kit, add Rnase A (provided in the kit) to the Resuspension Buffer and mix.
- If necessary, warm the Lysis Buffer to 37°C to dissolve any precipitate.
Preparing the Sample
- Pellet cells from 1-5 ml of overnight culture.
- Resuspend in 250 µL of Resuspension Buffer premixed with Rnase A. No cell clumps should remain.
- Add 250 µL of Lysis Buffer. Mix well by gentle inversion. Do not vortex.
- Incubate at room temperature for 2-5 minutes. Do not incubate more than 5 minutes.
- Add 250µL of Precipation Buffer, and mix well until a white precipitate is formed.
- Centrifuge for 10 minutes at maximum speed to pellet the debris.
Binding the DNA
- Carefully transfer the supernatant from Step 2.6 above onto the ChargeSwitch®-Pro MiniPrep Colum inserted in a Collection Tube.
- Centrifuge the column/tube at maximun speed for 30-60 seconds.
- Remove the column from the tube and discard the flow-through. Re-insert the column in the same tube.
Washing the Column
- Add 750µL of Wash Buffer 1 to the column.
- Centrifuge the column/tube at the maximun speed for 30-60 seconds.
- Remove the column from the tube and discart the flow-through. Re-insert the column in the tube;
- Add 250µL of Wash Buffer 2 to the column.
- Centrifuge the column/tube at maximun speed for 30-60 seconds.
- remove the column from the tube. Discard the flow-through and the Collection Tube.
Eluting the DNA
- Insert the column into an Elution Tube (provided in the kit).
- Add 50-100µL of Elution Buffer onto the column.
- Centrifuge the column/tube at maximun speed for 30-60 seconds.
- Optional:Remove the Elution Tube and transfer the eluate back onto the same column. Re-insert the column in the tube and centrifugate at maximun speed for 30-60 seconds. This step is recommended for maximun recovery.
- The eluate contains your purified plasmid DNA. Store DNA at 4°C or -20°C.
Plasmid digestion
Mix 10µL of extracted plasmid with 2µL of digestion buffer and 7µL of water. Add 1µL of restriction enzyme. Incubate for 1 hour at 37°C (except for fast digest enzymes which need only 5 min of incubation at 37°C). Then digestion products are migrated on an agarose gel.
gBlock plasmid insertion
The following ratio should be over 7: \[ \frac{vector\ size}{insert\ size}\times\frac{insert\ concentration}{vector\ concentration} \]
Gently centrifuge gBlocks. Add 100µL of TE buffer (final concentration should be around 10ng/µL). Vortex and incubate at 50°C for 20min. Mix 7µL of gBlocks with 1µL of extracted and linearized plasmid, 1µL of ligase and 1µL of ligase buffer. Incubate for 1h at RT.
List of plasmids constructed
Plasmid name | Backbone | Insert | Insert size (bp) |
---|---|---|---|
pPS16_001 | pUC19 | gBlock 1.1 | 960 |
pPS16_002 | pUC19 | gBlock 1.2 | 960 |
pPS16_003 | pUC19 | gBlock 2.1 | 1023 |
pPS16_004 | pUC19 | gBlock 2.2 | 808 |
pPS16_005 | pUC19 | gBlock 3.1 | 960 |
pPS16_006 | pUC19 | gBlock 3.2 | 960 |
pPS16_007 | pUC19 | gBlock 4.1 | 706 |
pPS16_008 | pUC19 | gBlock 4.2 | 1288 |
pPS16_009 | pUC19 | gBlock GFP 1-9 | 862 |
pPS16_010 | pUC19 | gBlock ATG linker RFB | 374 |
pPS16_011 | pUC19 | gBlock detection | 1020 |
pPS16_012 | pUC19 | gBlock St sgRNA | 310 |
pPS16_013 | pUC19 | gBlock ATG linker FKBP | 419 |
pPS16_014 | pUC19 | gBlock Nm sgRNA | 362 |
pPS16_015 | pUC19 | gBlock spacer1 | 900 |
pPS16_016 | pSB1C3 | gBlock 1.1 + gblock 1.2 + gblock 2.1 + gblock 2.2 | 3688 |
pPS16_017 | pSB1C3 | gBlock 3.1 + gblock 3.2 + gblock 4.1 + gblock 4.2 | 3809 |
pPS16_018 | pSB1C3 | gBlock ATG linker FKBP + GFP 10 | 757 |
pPS16_019 | pSB1C3 | gBlock ATG linker FRB + GFP 11 | 727 |
pPS16_020 | pSB1C3 | gBlock GFP 1-9 | 862 |
pPS16_021 | pSB1C3 | gBlock ATG linker FRB + GFP 11 + gBlock ATG linker FKBP + GFP 10 | X |
pPS16_022 | pSB1C3 | gBlock ATG linker FRB + GFP 11 + GFP 1.9 | X |
pPS16_023 | pSB1C3 | gBlock ATG linker FRB + GFP 11 + gBlock ATG linker FKBP + GFP 10 + gBlock GFP 1-9 | X |
pPS16_024 | pSB1C3 | gBlock 1.1 + gBlock 1.2 + gBlock + gBlock 2.1 + gblock 2.2 + gBlock 3.1 + gBlock 3.2 + gBlock 4.1 + gBlock 4.2 +gBlock GFP 1-9 | X |
pPS16_025 | pSB1C3 | gBlock detection + gBlock St sgRNA + gBlock Nm sgRNA + gBlock spacer 1 | X |
pPS16_026 | pSB1C3 | gBlock detection + gBlock St sgRNA + gBlock Nm sgRNA + gBlock spacer 1 - 50 pb | X |
pPS16_027 | pSB1C3 | gBlock detection + gBlock St sgRNA + gBlock Nm sgRNA + gBlock spacer 1 - 75 pb | X |
pPS16_028 | pSB1C3 | gBlock detection + gBlock St sgRNA + gBlock Nm sgRNA + gBlock spacer 1 - 100 pb | X |
pPS16_029 | pSB1C3 | gBlock detection + gBlock St sgRNA + gBlock Nm sgRNA + gBlock spacer 1 - 150 pb | X |
DNA electrophoresis on agarose gel
Gel preparation
Mix agarose and TAE buffer to get a final concentration of 0.8%(w/v). Microwave for 1-2min in order to melt the agarose. Let cool down for 10min and add BET up to 5µg/mL. This solution can be kept at 61°C. Pour the solution into the casting tray. Place the comb and let cool down for about 30min. Place the gel in an electrophoresis unit full of TAE and load the samples plus a ladder. Migrate at 100V for 20min. Visualize DNA fragments with UV light.
Polymerase chain reaction
List of PCR primers
Name | Description | Sequence 5'→3' |
---|---|---|
iPS120 | Reverse primer amplification gBlock 1-1 | TCCAGGATGCGCAGGTTGTTCAGCTTG |
iPS121 | Forward primer amplification gBlock 1-2 | GCAAGGCAGCGAGAGACCCCTGAC |
iPS122 | Reverse primer amplification gBlock 1-2 | TCGCTGCCCAGCACCAGCACCTTG |
iPS123 | Forward primer amplification gBlock 2-1 | GCTGCCCTTCAGCCGCACCTGGGAC |
iPS124 | Reverse primer amplification gBlock 2-1 | TTCTGCACCTGCTCCACGCGCACGG |
iPS125 | Forward primer amplification gBlock 2-2 | GACCGGCGTGTGGGTGCGCAACC |
iPS126 | Reverse primer amplification gBlock 3-1 | GGCACGGTCAGGTTGTTCAGGTCGTTC |
iPS127 | Forward primer amplification gBlock 3-2 | CACCGAGACCAAGAAGCTGAGCAAGG |
iPS128 | Reverse primer amplification gBlock 3-2 | CTGTCGTCGAAGGTGATGCTCAGG |
iPS129 | Forward primer amplification gBlock 4-1 | GCTGCCTGTACACCGGCAAGACCATC |
iPS130 | Reverse primer amplification gBlock 4-1 | AACAGGATGCTGTCCTCGAACTCC |
iPS131 | Forward primer amplification gBlock 4-2 | CAGCTACCAGGTGGACAGCAAGTTC |
iPS132 | Forward primer amplification St guide | TTGACAGCTAGCTCAGTCCTAGGTATAATG |
iPS133 | Reverse primer amplification Nm guide | CTAGCACTATCAGCGTTATTTAGCG |
iPS134 | Forward primer sequencing Cas plasmids from Addgene | TTTACGGGCATGCATAAGGCTCG |
iPS135 | Reverse primer sequencing Cas plasmids from Addgene | GTACCTAGGACTGAGCTAGCCG |
iPS136 | Reverse primer sequencing DS-SPCasN- from Addgene | CTGCATGAAGTTCCGGTTGGC |
iPS137 | Forward primer sequencing DS-SPCasN- from Addgene | GAAACAGCTCAAGAGGCGCCG |
iPS138 | Prefix | GAATTCGCGGCCGCTTCTAGAG |
iPS139 | Suffix | CTGCAGCGGCCGCTACTAGTA |
iPS140 | Primer to amplify gBlock 1.1 if prefix missed | GAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCT |
iPS141 | Primer to amplify gBlock 2.2 terminator and add Gibson sequence | CCAAAGCTGGACTTCTAATAACGCTGATAGTGCTAGTGTAGATCGC |
iPS142 | Primer to amplify 2.2 and add linker TEV | ACCCTGGAAGTACAGGTTTTCACCACCAGAACCACCACCACCGCGCACAGGAGGGCGCTTCTT |
iPS143 | Primer to amplify 3.1 and add linker TEV | TGAAAACCTGTACTTCCAGGGTGGTTCTGGTGGTGGTGGTTCTAGCGACCTGGTGCTGGGC |
iPS144 | Primer to amplify 4.2 and add Gibson sequence | CTATCAGCGTTATTAGAAGTCCAGCTTTGGCTTGTCTCC |
iPS145 | Forward primer to amplify FKBP and add Gibson sequence | GAGAAATACTAGATGATGGGTGTTCAGGTTGAAAC |
iPS146 | Reverse primer to amplify FKBP and add Gibson sequence | TCCACCTCCTACATCTTCCAGTTTCAGCAGTTCAAC |
iPS147 | Gibson to amplify linker L30 in gBlock 2.2 and add Gibson sequence | CTGCTGAAACTGGAAGATGTAGGAGGTGGAGGT |
iPS148 | Gibson to amplify promoter in gBlock 1.1 and add Gibson sequence | CTGAACACCCATCATCTAGTATTTCTCCTCTTTATTATTGTAC |
iPS149 | Forward primer to amplify FRB and add Gibson sequence | GAGAAATACTAGATGATCCTGTGGCACGAAATG |
iPS150 | Reverse primer to amplify FRB and add Gibson sequence | ATCGGATCCGAGCTCTTTAGAGATACGACGGAAAACG |
iPS151 | Primer to amplify linker L30 in gBlock 4.2 and add Gibson sequence | CCGTCGTATCTCTAAAGAGCTCGGATCCGATGTA |
iPS152 | Primer to amplify promoter in gBlock 3.1 and add Gibson sequence | GTGCCACAGGATCATCTAGTATTTCTCCTCTTTATTATTGTAC |
iPS153 | Forward primer to amplify gBlock detection | CGAGTCCCTAAACCCTAACCCTAACCCTAACCC |
iPS154 | Reverse primer to amplify gBlock detection | GCTAACTTAGTTCCAATCCATAAGACACCATTACT |
iPS155 | Forward primer to amplify gBlock spacer | TGGATTGGAACTAAGTTAGCCTAGAGAATC |
iPS156 | Reverse primer to amplify gBlock spacer | TAGCTGTCAATCGACTGCAATTCATTATGT |
iPS157 | Forward primer to amplify gBlock Nm sgRNA | TTGCAGTCGATTGACAGCTAGCTCAGTCCT |
iPS158 | Reverse primer to amplify gBlock Nm sgRNA | TAGCTGTCAACACTAGCACTATCAGCGTTATTTAGC |
iPS159 | Forward primer to amplify gBlock St sgRNA | AGTGCTAGTGTTGACAGCTAGCTCAGTCCTAGGTATA |
iPS160 | Reverse primer to amplify gBlock St sgRNA | GATGCCTCTACGCAGAAAGGCCCACCCG |
iPS161 | Forward primer to amplify plasmid pZA11 | CCTTTCTGCGTAGAGGCATCAAATAAAACGAAA |
iPS162 | Reverse primer to amplify plasmid pZA11 | GGTTAGGGTTTAGGGACTCGAGGTGAAG |
iPS163 | Reverse primer for construction pZA11-detection-sg RNA St & Nm | GAAGCATTCCCGGGTTACAC |
iPS164 | Forward primer for construction pZA11-detection-sg RNA St & Nm - 50 bp | GTGTAACCCGGGAATGCTTCCAACCACAGGCTAGATCTGT |
iPS165 | Forward primer for construction pZA11-detection-sg RNA St & Nm - 75 bp | GTGTAACCCGGGAATGCTTCCGAGATATGGTTGCTAGATACG |
iPS166 | Forward primer for construction pZA11-detection-sg RNA St & Nm - 100 bp | GTGTAACCCGGGAATGCTTCACCTCCAGATCGATTTTATCGG |
iPS167 | Forward primer for construction pZA11-detection-sg RNA St & Nm - 150 bp | GTGTAACCCGGGAATGCTTCTGAGTCTATTACGACTTCAAGGC |
iPS168 | Forward primer for pSB1C3 verification (iGEM) | CCACCTGACGTCTAAGAAAC |
iPS169 | Reverse primer for pSB1C3 verification (iGEM) | GTATTACCGCCTTTGAGTGA |
iPS170 | Primer to verify gBlobk 2.1 - 2.2 junction | GGTCACATGGAGACCGTGAAG |
iPS171 | Primer to verify gBlobk 4.1 - 4.2 junction | TAGCCAGCTGAACCTGTGGA |
iPS172 | Primer to amplify pSB1C3 and add Gibson sequence | TACTAGTAGCGGCCGCTG |
iPS173 | Primer to correct mutation 1 dCas9 St - GFP 11 and add Gibson sequence | TGAACAACCTGACCGTGCCCACCGAGACCAAGAAGCTGAG |
iPS174 | Primer to correct mutation 1 dCas9 St - GFP 11 and add Gibson sequence | CTCAGCTTCTTGGTCTCGGTGGGCACGGTCAGGTTGTTCA |
iPS175 | Primer to correct mutation 2 dCas9 St - GFP 11 and add Gibson sequence | TCGAGGACAGCATCCTGTTCAGCTACCAGGTGGACAGCAA |
iPS176 | Primer to correct mutation 2 dCas9 St - GFP 11 and add Gibson sequence | TTGCTGTCCACCTGGTAGCTGAACAGGATGCTGTCCTCGA |
iPS83 | 4bases_Prefix | ATTCGAATTCGCGGCCGCTTCTAGAG |
iPS84 | 4bases_suffix | AGTACTGCAGCGGCCGCTACTAGTA |
iPS41 | PSB1C3 amplification | GCCGCTGCAGTCCGGCAAAAAA |
iPS42 | PSB1C3 amplification | ATGAATTCCAGAAATCATCCTTAGCG |
Ptet_R | Primer for Gibson assembly plasmid | TTCTGCTGATGTGCTCAGTATC |
Link-TDdcas_F | Primer for Gibson assembly link-TDdcas | TGAAAACCTGTACTTCCAGGGTGGTTCTG GTGGTGGTGGTTCTAAGAAGGAGATCAA |
Ter_TDdcas_R | Primer for Gibson assembly TDdcas-Ter | CTTTAATGAATTCGGTCAGTGCGAGGAAT GGTCAAGGTCCCAG |
Tet-SPdcas_F | Primer for Gibson assembly Tet-SPdcas | GATACTGAGCACATCAGCAGGAACTTTTA CTAGAGGAGGAGGCA |
Link-SPdcas_R | Primer for Gibson assembly SPdcas-link | CACCCTGGAAGTACAGGTTTTCACCACCA GAACCACCACCACCGTCTCCACCGAGCT |
Ptet_F | Primer for Gibson assembly plasmid | CGCACTGACCGAATTCATTAAAG |
1152_pheoF | Forward primer amplification pUC19 insert | GAATTCGAGCTCGGTACCC |
1151_pheoR | Reverse primer amplification pUC19 insert | AAGCTTGCATGCCTGCAG |
PCR with Taq PCRx DNA Polymerase (recombinant) or DreamTaq DNA Polymerase from ThermoFisher Scientific
- Prepare enough PCR master mix for the number of colonies analyzed plus one extra. Mix the following reagents :
Components | Volume |
---|---|
10x Taq buffer with KCl | 2µL |
MgCl2 (25mM) | 1.2µL |
dNTP (10mM) | 2µL |
Primers mix (10µM each) | 1.2µL |
Taq DNA polymerase | 0.1µL |
Nuclease-free water | up to 20µL |
Total volume | 20µL |
or
Components | Volume |
---|---|
10X DreamTaq Green Buffer | 2.5µL |
dNTP (10mM) | 2.5µL |
Primers mix (10µM each) | 1µL |
DreamTaq DNA polymerase | 0.13µL |
Nuclease-free water | up to 25µL |
Total volume | 25µL |
- Mix gently and aliquot 20μL or 25μL of the mix into the PCR tubes on ice.
- Pick up an individual colony with a sterile pipette tip and resuspend it in 20μL or 25μL of the PCR master mix (or take 1μL of liquid preculture). Make a short strike with the same tip over culture plate to save the clone for repropagation.
- Perform PCR as follow (annealing temperature can be calculated here):
Step | Temperature | Time |
---|---|---|
Initial denaturation | 95°C | 3min |
30 cycles | 94°C | 30sec |
Tannealing | 30sec | |
72°C | 1min/kb | |
Final Extension | 72°C | 7min |
Hold | 4°C | $\infty$ |
- Analyze on a gel for the presence of the PCR product of the expected length.
PCR with Q5® High-Fidelity 2X Master Mix from NEB
- Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 25μl of reaction, mix the following reagents :
Components | Volume |
---|---|
Q5 High-Fidelity 2X Master Mix | 12.5µL |
Primers mix (10µM each) | 2.5µL |
Template DNA (from extractions) | 1µL |
Nuclease-free water | up to 25µL |
Total volume | 25µL |
- Mix gently and aliquot 25μl of the mix into the PCR tubes on ice.
- Perform PCR as follow (annealing temperature can be calculated [http://tmcalculator.neb.com/#!/ here]):
Step | Temperature | Time |
---|---|---|
Initial denaturation | 98°C | 3min |
30 cycles | 98°C | 10sec |
Tannealing | 20sec | |
72°C | 30sec/kb | |
Final Extension | 72°C | 2min |
Hold | 4°C | $\infty$ |
- Analyze on a gel for the presence of the PCR product of the expected length.
PCR with Phusion High-Fidelity DNA Polymerase from ThermoFisher Scientific
- Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 50μl of reaction, mix the following reagents :
Components | Volume |
---|---|
Buffer 5x HF | 10µL |
dNTP (10mM) | 1µL |
Primers mix (10µM each) | 5µL |
Template DNA (from extractions) | 1µL |
Phusion DNA polymerase | 0,25 µL |
Nuclease-free water | up to 50µL |
Total volume | 50µL |
- Mix gently and aliquot 50μl of the mix into the PCR tubes on ice.
- Perform PCR as follow (annealing temperature can be calculated here):
Step | Temperature | Time |
---|---|---|
Initial denaturation | 98°C | 30sec |
30 cycles | 98°C | 10sec |
Tannealing | 30sec | |
72°C | 30sec/kb | |
Final Extension | 72°C | 7min |
Hold | 4°C | $\infty$ |
- Analyze on a gel for the presence of the PCR product of the expected length.
Purification : PCR clean-up with NucleoSpin Gel and PCR Clean-up
Adjuste DNA binding condition
PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1.
Binding the DNA
NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube.
Wash silica membrane
700µL of Buffer NT3 is added in each column. The tubes were centrifuged at 11,000 rpm for 30s. The flow-through is discarded and the column put back into the collection tube. This step is repeated another time.
Dry silica membrane
The tubes were centrifuged 1min at 11,000 rpm to removed completely.
Elute DNA
The NuleoSpin gel and PCR clean-up column were put into new tube (1.5mL) and 30*L of Buffer NE was added. The tube were left incubated for 1 at RT and then centrifuged 1min at 11,000 rpm.
- Analyze on a gel for the presence of the PCR product of the expected length.
DNA extraction from agarose gels with NucleoSpin Gel and PCR Clean-up
Excise DNA fragment/solubilize gel slice
Take a clean scalpel to excise the DNA fragment from an agarose gel. Remove all excess agarose.
Determine the weight of the gel slice and transfer it to a clean tube. For each 100 mg of agarose gel<2% add 200µL Butter NT1.
For gels containing >2%, double the volume of Buffer NT1.
Incubate sample for 5-1à min at 50°C. Vortex the sample briefly every 2-3 min until the gel slice is completely dissolved!
Bind DNA
Place a NucleoSPin Gel and PCR Clean-Up COlumn into a Collection Tube (2mL) and load up to 700µL sample.
Centrifuge for 30s at 11 000x g. Discard flow-through and place the column nack into the collection tube.
PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1.
Bind DNA
NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube.
Load remaining sample if necessary and repeat the centrifugation step.
Wash silica membrane
Add 700µL Buffer NT3 to the NucleoSpin Gel and PCR Clean-up Column. Centrifuge for 30s at 11 000 x g. Discard flow-through and place the column back into the collection tube.
Recommended: Repeat previous washing step to minimize chaotropic salt carry-over and low A260/A260.
Dry silica membrane
Centrifuge for 1 min at 1 000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube.
Elute DNA
Place the NucleoSpin Gel and PCR Clean-up Column into a new 1.5mL microcentrifuge tube. Add 15-30µL Buffer NE and incubate at room temperature (18-25°C) for 1 min. Centrifuge for 1 min at 11 000 x g.
- Analyze on a gel for the presence of the PCR product of the expected length.