15/7/2016

In the lab today: Itay, May, Tomer
Planning synthetic DNA
Planning 8 synthetic SNPs and placing an order.

16/7/2016

In the lab today: Itay, May, Tomer
Planning synthetic DNA
Planning 7 synthetic SNPs and placing an order.

The final SNPs (Single nucleotide polymorphism)
Final Order Table

Number	Taste	RS
1	Sweet	rs35874116
2	Sweet	rs307355
3	PTC	rs713598
4	PTC	rs1726866
5	PTC	rs1024639
6	Consuming Alcohol	rs846672
7	Coffee Bitterness	RS765007
8	Coffee Bitterness	RS2234001
9	Coffee Bitterness	RS2234012
10	Coffee Bitterness	RS2227264
11	Grapefruit juice bitterness	rs10772420
12	Cilantro Preference	rs72921001
13	Taste of NaC1 & Sour	rs17492553
14	Taste of NaC1 & Sour	rs34160967
16	Umami& Monosodium gluten	rs76755863

19/7/2016

In the lab today: Avital, Gal, Lidor
Planning 5 gRNA for CRISPR reaction

Taste/NoTaste	Spacer	PAM
No Taste	TCAGTTTTGTGGCAGATGAC	AGG
No Taste	CACATCAGTGAGGAGATTCT	AGG
No Taste	TCGTGTGTGTCATGAAAGCT	TGG
No Taste	GGCCACGGGCACGGTTGTAGC	CGG
(non targeting)	aggatcacct gagtccaggg	-

1. TAS2R3 RS765007

CGACAGACTAAATTGGGCAGAGACAAGAGACAGGTACAGTGAAGCAACAGGTAGAGGAGTAGATTAACGAG
AAAAATATCACATCAGTGAGGAGATTCTA[T/G]GTATCAACAGAAAGAACAAAGATCAGGGCTGCCTAATTGC
TGACATGATGGGACTCACCGAGGGGGTGTTCCTGATTCTGTCTGGCACTCAGTTCACACT

2. TAS2R3 RS765007

CGACAGACTAAATTGGGCAGAGACAAGAGACAGGTACAGTGAAGCAACAGGTAGAGGAGTAGATTAACGAG
AAAAATATCACATCAGTGAGGAGATTCTA[T/G]GTATCAACAGAAAGAACAAAGATCAGGGCTGCCTAATTGC
TGACATGATGGGACTCACCGAGGGGGTGTTCCTGATTCTGTCTGGCACTCAGTTCACACT

3. TAS1R1 rs34160967

AGAAGCCTATGCCCGGGCAGACAAGAAGGCCCCTAGGCCTTGCCACAAGGGCTCCTGGTGCAGCAGCAATCA
GCTCTGCAGAGAATGCCAAGCTTTCATG[G/A]CACACACGATGCCCAAGCTCAAAGCCTTCTCCATGAGTTCTG
CCTACAACGCATACCGGGCTGTGTATGCGGTGGCCCATGGCCTCCACCAGCTCCTGGG

4. TAS1R3 rs307377

CACACGCTCCTGGGTCAGCTTCGGCCTAGCGCACGCCACCAATGCCACGCTGGCCTTTCTCTGCTTCCTGGGC
ACTTTCCTGGTGCGGAGCCAGCCGGGC[T/C]GCTACAACCGTGCCCGTGGCCTCACCTTTGCCATGCTGGCCTAC
TTCATCACCTGGGTCTCCTTTGTGCCCCTCCTGGCCAATGTGCAGGTGGTCCTCAG

5. NEGATIVE CONTROL CLASSIC gRNA

(non targeting)

1/8/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., Gal, Amit K.
Collecting DNA samples from 43 people.

The collecting was done in the framework of school. Each of the participants came to the station we set up at the school and filled out an questionnaire and then answered a questionnaire while tasting. The questionnaire included questions tailored to the tastes of the participants: sweet, umami, sour, salty and bitter. Each participant stated his sensitivity to different tastes when tried, the listing the participant’s phenotype. All data was collected into a general survey which summarized the results of the participants.

Shelly has no sensitivity to - PTC

Lior on the other hand cannot stand the taste of PTC

At the same time a saliva sample was taken from each of the participants. The saliva sample will be a source of DNA of all tested in the future. The samples were collected on a unique membrane. Next to each saliva sample a number marked the participant. Respectively the questionnaire of the participant was marked. This was done so that we could compare the results between the genotype of the participant and the phenotype stated.

4/8/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., Gal, Amit K.
Collecting DNA samples from another 30 people
Listing the phenotype similar to that done in the laboratory in the previous sampling on the 1/8/2016.
The data collection served us for the benefit of the survey we conducted on the degree of preference of the population studied.

7/8/2016

In the lab today: Daniel, Yuval, Shir, Shahar, AMIT S., Gal, Amit K., Tomer
Producing DNA from 70 samples collected on the dates 4/8, 1/8.
DNA samples were placed in storage at -4 ° C.

10/8/2016

In the lab today: Daniel, Yuval, Shir, Shahar, AMIT S., Gal, Amit K., Tomer
The plasmid planning in stage B of the experiment.
The plasmid will contain all the SNPs which were planned on the 16/07/2016.

25/8/2016

In the lab today: Daniel, Yuval, Shir, Shahar, AMIT S., Gal, Amit K., Tomer
We performed a preliminary experiment to check the normality of the Taqman system.
The preliminary experiment was performed on a sample of saliva from Professor Daniel Berkowitz.
In order to ensure that the system is reset and works properly on every one of the SNP ordered.

Below is a sample of 15 primary results received for the different SNPs. We checked for the haplotype of all genotypes tested, using the Fluidigm gene chip array.

SNPs are screened using the Fluidigm BioMark apparatus (Fluidigm Corp.) with 15 Assay-specific TaqMan.
Assays along with PCR master mix run by loading 5µl into each well of the primed 96.96 Fluidigm Chip.

96.96 Fluidigm Chip

The chip is then placed in the integrated fluidic circuit controller and loaded before analysis with the BioMark reader. The following thermal cycling protocol are usually used: 50˚C (2 minutes), 70˚C (30 minutes), 25˚C (10 min), 50˚C (2 minutes), and 95˚C (4 minutes). This is followed by 40 cycles of 95˚C (10 seconds) and 61˚C (30 seconds).

Data is analysed and cycle threshold (CT) values are determined using BioMark PCR analysis software (Fluidigm Corp.), and automated genotyping calling is carried out using an algorithm based on the change in CT (DCT) values between wild-type and mutant calling.

Taste SNPs will be marked by FAM dye, Non-taste SNPs will be marked by VIC dye Below is a sample of 15 preliminary results received for the different SNPs.

Results

Coffee bitterness RS765007

Coffee bitterness RS2234001

PTC rs10246939

Umami & Monosodium gluten rs307377

Taste of NaCl & Sour rs17492553

Taste of NaCl & Sour rs34160967

Etai and Aviad examing the chip after preparation

01/09/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., Gal, Amit K., Tomer, Etay, Avital.
Performing an experiment for all 70 samples collected.
The experiment was performed under the same conditions in which the experiment was conducted on 08.25.2016.
Here is a collection of the results received in the Fluidigm BioMark apparatus, using the Taqman method.

15/09/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., GAL, Amit K., Tomer, Etay, Avital, May
Cas9 reaction
In vitro cutting of dsDNA (Puc 57 vector) using Cas9/synthetic RNA
In order to test in vitro, the RNAs will have to include a 20nt spacer that matches to the DNA we wish to cut in vitro. 1. Resuspend crRNA and tracrRNA.
2.annealing the crRNA and tracrRNA.
3.Visualize on a gel.

We succeeded! PUC57 plasmid was split using the CRISPR system. The cas9 and its operating system identified the SNPs sequences inserted into the plasmid.

17/09/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., GAL, Amit K., Tomer, Etay, Avital, May
Cutting of the plasmid in vitro by different combinations of the operating system cas9 failed. Only individual cuts worked.

19/09/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., GAL, Amit K., Tomer, Etay, Avital, May
Part submission- Document the part submission.

20/09/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., GAL, Amit K., Tomer, Etay, Avital, May
Work on statistical results which examine the results of the Taqman system (genotype) in relation to phenotype.

01/10/2016

In the lab today: Daniel, Yuval, Shir, Shahar, Amit S., Tomer, Etay, Avital, May
Part submission- Prepare Physical delivery.