Difference between revisions of "Team:British Columbia/Project/S-Layer"

Line 45: Line 45:
 
<h2 class="page-header">Abstract</h2>
 
<h2 class="page-header">Abstract</h2>
 
<p>Lignocellulosic biomass,the most abundant renewable resources in nature, represents a promising alternative to fossil fuels for sustainable production of chemicals and material. However, the main technological obstacle for industrial exploitation of biomass is the recalcitrant nature of lignocellulosic polymers. One approach to harness the energy contained in biomass is to convert the lignocellulosic polymers in simple sugars, which can be further transformed in valuable compounds, using microorganisms. Some anaerobic microorganisms have developed approaches to break down recalcitrant plant biomass using elaborate extracellular enzyme complexes, containing a scaffolding protein with many attached cellulolytic enzymes. The assembly of such complexes requires engineering of highly specific cohesin-dockerin interactions.  
 
<p>Lignocellulosic biomass,the most abundant renewable resources in nature, represents a promising alternative to fossil fuels for sustainable production of chemicals and material. However, the main technological obstacle for industrial exploitation of biomass is the recalcitrant nature of lignocellulosic polymers. One approach to harness the energy contained in biomass is to convert the lignocellulosic polymers in simple sugars, which can be further transformed in valuable compounds, using microorganisms. Some anaerobic microorganisms have developed approaches to break down recalcitrant plant biomass using elaborate extracellular enzyme complexes, containing a scaffolding protein with many attached cellulolytic enzymes. The assembly of such complexes requires engineering of highly specific cohesin-dockerin interactions.  
Our approach focuses on adapting the surface layer of Caulobacter crescentus for the  for highly efficient display of cellulolytic enzymes. We specifically chose C. crescentus as it natively expresses a two dimensional crystal lattice protein called a surface layer (S-Layer), which can be engineered to work as an enzyme display. Our goals were to embed cellulolytic enzymes into the S-Layer protein to confirm their proper folding and activity. We believe that our approach will simplify the process of "cellulosome" engineering by exploiting the robust secretion and display system of Caulobacter. The developed platform can be easily adapted for the display of different enzymatic activities.  
+
Our approach focuses on adapting the surface layer of <i>Caulobacter crescentus</i> for the  for highly efficient display of cellulolytic enzymes. We specifically chose C. crescentus as it natively expresses a two dimensional crystal lattice protein called a surface layer (S-Layer), which can be engineered to work as an enzyme display. Our goals were to embed cellulolytic enzymes into the S-Layer protein to confirm their proper folding and activity. We believe that our approach will simplify the process of "cellulosome" engineering by exploiting the robust secretion and display system of <i>Caulobacter</i>. The developed platform can be easily adapted for the display of different enzymatic activities.  
 
</p>
 
</p>
 
<h2 class="page-header">Key Achievements</h2>
 
<h2 class="page-header">Key Achievements</h2>
 
<ul style="font-size: 13px">
 
<ul style="font-size: 13px">
<li>Cloned 5 different cellulase constructs, such as β-1,4-endoglucanase (Endo5A), β-1,4-glucosidase (Gluc1C), β-1,4-exoglucanase (cex) and 2 versions of  β-1,4-endoglucanase(E1) in p4A723 plasmid containing rsaA protein and transformed into C. crescentus for the display on cell surface.</li>
+
<li>Cloned 5 different cellulase constructs, such as β-1,4-endoglucanase (Endo5A), β-1,4-glucosidase (Gluc1C), β-1,4-exoglucanase (CEX) and 2 versions of  β-1,4-endoglucanase(E1) in p4A723 plasmid containing rsaA protein and transformed into <i>C. crescentus</i> for the display on cell surface.</li>
<li>Cloned 4 different cellulases - Endo5A, Gluc1C, E1, G12, cex into pSB1C3 and submitted as parts BBa…… </li>
+
<li>Cloned 4 different cellulases - Endo5A, Gluc1C, E1, G12, CEX into pSB1C3 and submitted as parts BBa…… </li>
 
<li>Confirmed surface protein (rsaA)-cellulase fusion proteins expression of  Endo5A, Gluc1C, E1_422, E1_399 constructs</li>
 
<li>Confirmed surface protein (rsaA)-cellulase fusion proteins expression of  Endo5A, Gluc1C, E1_422, E1_399 constructs</li>
 
<li>Confirmed increased cellulase activity of Endo5A, Gluc1C, E1_422, E1_399 cellulase constructs expressed on surface of C. crescentus</li>
 
<li>Confirmed increased cellulase activity of Endo5A, Gluc1C, E1_422, E1_399 cellulase constructs expressed on surface of C. crescentus</li>
 
<li> Confirmed baseline intracellular cellulase activity of 4 different cellulase constructs expressed in E. coli: Endo5A, Gluc1C, E1, Gluc1C</li>
 
<li> Confirmed baseline intracellular cellulase activity of 4 different cellulase constructs expressed in E. coli: Endo5A, Gluc1C, E1, Gluc1C</li>
<li>Codon-optimized β-1,4-endoglucanase (cenA) derived from Registry for expression in Caulobacter. Confirmed its expression and cellulase activity on the surface of Caulobacter</li>
+
<li>Codon-optimized β-1,4-endoglucanase (cenA) derived from Registry for expression in <i>Caulobacter</i>. Confirmed its expression and cellulase activity on the surface of <i>Caulobacter</i></li>
 
</ul>
 
</ul>
 
<h2 class="page-header">Design</h2>
 
<h2 class="page-header">Design</h2>

Revision as of 16:41, 10 October 2016

Main CSS S-Layer

S-Layer Engineering

Lignocellulosic biomass,the most abundant renewable resources in nature, represents a promising alternative to fossil fuels for sustainable production of chemicals and material. However, the main technological obstacle for industrial exploitation of biomass is the recalcitrant nature of lignocellulosic polymers. One approach to harness the energy contained in biomass is to convert the lignocellulosic polymers in simple sugars, which can be further transformed in valuable compounds, using microorganisms. Some anaerobic microorganisms have developed approaches to break down recalcitrant plant biomass using elaborate extracellular enzyme complexes, containing a scaffolding protein with many attached cellulolytic enzymes. The assembly of such complexes requires engineering of highly specific cohesin-dockerin interactions. Our approach focuses on adapting the surface layer of Caulobacter crescentus for the for highly efficient display of cellulolytic enzymes. We specifically chose C. crescentus as it natively expresses a two dimensional crystal lattice protein called a surface layer (S-Layer), which can be engineered to work as an enzyme display. Our goals were to embed cellulolytic enzymes into the S-Layer protein to confirm their proper folding and activity. We believe that our approach will simplify the process of "cellulosome" engineering by exploiting the robust secretion and display system of Caulobacter. The developed platform can be easily adapted for the display of different enzymatic activities.

  • Cloned 5 different cellulase constructs, such as β-1,4-endoglucanase (Endo5A), β-1,4-glucosidase (Gluc1C), β-1,4-exoglucanase (CEX) and 2 versions of β-1,4-endoglucanase(E1) in p4A723 plasmid containing rsaA protein and transformed into C. crescentus for the display on cell surface.
  • Cloned 4 different cellulases - Endo5A, Gluc1C, E1, G12, CEX into pSB1C3 and submitted as parts BBa……
  • Confirmed surface protein (rsaA)-cellulase fusion proteins expression of Endo5A, Gluc1C, E1_422, E1_399 constructs
  • Confirmed increased cellulase activity of Endo5A, Gluc1C, E1_422, E1_399 cellulase constructs expressed on surface of C. crescentus
  • Confirmed baseline intracellular cellulase activity of 4 different cellulase constructs expressed in E. coli: Endo5A, Gluc1C, E1, Gluc1C
  • Codon-optimized β-1,4-endoglucanase (cenA) derived from Registry for expression in Caulobacter. Confirmed its expression and cellulase activity on the surface of Caulobacter

Cloning of cellulase enzymes into rsaA plasmid in C. crescentus

The synthesized cellulase DNA was amplified using PCR with HF Phusion polymerase in 100 μl reactions.The following primers were used to amplify the selected region of cellulases genes and to add the BglII and PstI or NheI cut sites for cloning in p4A_723 plasmid:

 
Endo5A endo5a_34_fwd 5’-TCCAGATCTAGCGTCAAGGGGTATTACCAC
endo5a_385_rev 5’-TCCATCTGCAGACACCGGCTTCATGATCCG
Gluc1c Gluc1c_4_fwd TCCAGATCTAACACGTTCATCTTTCCGGC
gluc1c_448_rev TCCATCTGCAGAGAACCCGTTCTTGGCCAT
E1_399 E1_42_fwd TCCAGATCTGTTGCAGGCGGGGGTTATTG
E1_399_rev TCCATCTGCAGAAACCGGGTCAAATATCGATGATTTTATC
E1_422 E1_42_fwd TCCAGATCTGTTGCAGGCGGGGGTTATTG
E1_422_rev TCCATCTGCAGATGAGGGGGAGGGAGAC
G12 G12_35_fwd TCCAGATCTGCGACGACCTCCACG
G12_274_rev TCCATCTGCAGATGAGGGGGTGGGAGTAG
CEX JN CEX -1 GGGAGATCTGCGACCACGCTCAAGGAGGCCGCC
JN CEX - 2 CTAGCTAGCCCCGGCCGGACCGGACGTCGG

For the cloning of Endo5A, GlucIC, G12, E1_422 and E1_399 in P4A723 rsaA plasmid, the amplified products and the isolated with AllPrep DNA/RNA/Protein Mini Kit (Qiagen) p4A723 plasmid DNA were digested with Bgl II and Pst I restriction enzymes (NEB). For the cloning of CEX construct, the plasmid and amplified product were digested with BglII and NheI restriction enzymes. The plasmid digests were purified by agarose gel purification, while PCR product digests were purified by PCR purification using NucleoSpin® Gel and PCR Clean-up (Macherey-Nagel).Purified digests were ligated using T4 ligase(NEB) and the ligation mixes were then transformed in chemically competent DH5α E. coli.

Transformed colonies were then plated on and selected from a LB-CM plate and grown overnight in LB-CM media. Recombinant plasmid was then isolated using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) and sent for Sanger sequence for confirmation.

After sequence confirmation, the isolated construct DNA were electroporated into electrocompetent C. Crescentus and colonies were grown on a PYE-CM plate. One colony was selected and streaked onto a fresh plate, which would be used for all future assays.

Cloning of cellulase enzymes into pSB1C3 with ptac promoter and rbs

Synthesized cellulase enzymes were amplified using high fidelity Low pH extraction (Walker et al. 1992) was performed using different pHs of HEPES buffer to remove only crystalline s-layer without lysing cells. Proteins were then stored in epindorf tubes at -20°C to be used at a later date.

Surface layer fusion protein expression confirmation

Caulobacter Cellulase Activity Analysis

For cellulase enzyme activity measurement, triplicate 5mL PYE-CM starter cultures were grown at 30°C in 10 mL tubes shaking for 2 days. Cultures were taken out of incubator and optical density at 600 nm was measured. All cultures were then normalized to the lowest OD 600 nm by diluting the remaining culture with PYE. 1 mL of each sample was removed and washed 3 times with fresh PYE to remove and lysed cells that may interfere with cellulase activity results.

Two separate conditions were tested using the Cellulase Activity Assay Protocol adopted from (): one with washed cells and the other with unwashed cells (all samples had been normalized previously). 150 uL of culture from the two separate conditions were aliquoted into a clear 96 well plate then 150 uL assay mix (0.1 mg/ml DNPC in xx M pH 5.5 potassium acetate buffer) was added into the each occupied well.

OD 400 nm was measured every 30 minutes for 5 hours by an XX plate reader. Between measurements the culture was incubating at 30°C.

Growth of Caulobacter displaying cellulases on cellobiose and cellulose as sole carbon sources