Difference between revisions of "Team:British Columbia/Project/S-Layer"

Abstract

Lignocellulosic biomass,the most abundant renewable resources in nature, represents a promising alternative to fossil fuels for sustainable production of chemicals and material. However, the main technological obstacle for industrial exploitation of biomass is the recalcitrant nature of lignocellulosic polymers. One approach to harness the energy contained in biomass is to convert the lignocellulosic polymers in simple sugars, which can be further transformed in valuable compounds, using microorganisms. Some anaerobic microorganisms have developed approaches to break down recalcitrant plant biomass using elaborate extracellular enzyme complexes, containing a scaffolding protein with many attached cellulolytic enzymes. The assembly of such complexes requires engineering of highly specific cohesin-dockerin interactions. Our approach focuses on adapting the surface layer of Caulobacter crescentus for the for highly efficient display of cellulolytic enzymes. We specifically chose C. crescentus as it natively expresses a two dimensional crystal lattice protein called a surface layer (S-Layer), which can be engineered to work as an enzyme display. Our goals were to embed cellulolytic enzymes into the S-Layer protein to confirm their proper folding and activity. We believe that our approach will simplify the process of "cellulosome" engineering by exploiting the robust secretion and display system of Caulobacter. The developed platform can be easily adapted for the display of different enzymatic activities.

Key Achievements

• Cloned 5 different cellulase constructs, such as β-1,4-endoglucanase (Endo5A), β-1,4-glucosidase (Gluc1C), β-1,4-exoglucanase (CEX) and 2 versions of β-1,4-endoglucanase(E1) in p4A723 plasmid containing rsaA protein and transformed into C. crescentus for the display on cell surface.
• Cloned 4 different cellulases - Endo5A, Gluc1C, E1, G12 into pSB1C3 and submitted as parts BBa……
• Confirmed surface protein (rsaA)-cellulase fusion proteins expression of Endo5A, Gluc1C, E1_422, E1_399 constructs
• Confirmed cellulase activity of Endo5A, Gluc1C, E1_422, E1_399 cellulase constructs expressed on the surface of C. crescentus
• Confirmed baseline intracellular cellulase activity of 4 different cellulase constructs expressed in E. coli: Endo5A, Gluc1C, E1, Gluc1C
• Codon-optimized β-1,4-endoglucanase (cenA) derived from Registry for expression in Caulobacter. Confirmed its expression and cellulase activity on the surface of Caulobacter

Design

Methods

All plasmid DNA extractions were performed with QIAprep Spin Miniprep Kit (Qiagen). DNA purification from gels or PCR mixtures were done with NucleoSpin® Gel and PCR Clean-up kit(Macherey-Nagel).

Cloning of cellulase enzymes into rsaA plasmid in C. crescentus

The synthesized cellulase DNA was amplified using PCR with HF Phusion polymerase in 100 μl reactions.The following primers were used to amplify the selected region of cellulases genes and to add the BglII and PstI or NheI cut sites for cloning in p4A_723 plasmid:

For the cloning of Endo5A, GlucIC, G12, E1_422 and E1_399 in P4A723 rsaA plasmid, the amplified products and the isolated p4A723 plasmid DNA were digested with BglII and PstI restriction enzymes (NEB). For the cloning of CEX construct, the plasmid and amplified product were digested with BglII and NheI restriction enzymes. The plasmid digests were purified by agarose gel purification, while PCR product digests were purified by PCR purification. Purified digests were ligated using T4 ligase(NEB) and the ligation mixes were then transformed in chemically competent DH5α E. coli.

Transformed colonies were then plated on and selected from a LB-CM plate and grown overnight in LB-CM media. Recombinant plasmid was then isolated and sent for Sanger sequencing for confirmation.

After sequence confirmation, the isolated construct DNA were electroporated into electrocompetent C.crescentus and colonies were grown on a PYE-CM plate. One colony was selected and streaked onto a fresh plate, which would be used for all future assays.

Cloning of cellulase enzymes into pSB1C3 plasmid with Ptac promoter and rbs

The synthesized cellulases genes were amplified using PCR with HF Phusion polymerase in 100 μl reactions.The following primers were used to amplify the selected region of cellulases genes and to add BioBrick Prefix and Suffix: Endo5A Primers 5'-TCCgaattcgcggccgcttctagATGAAGAAGAAGGGC and 5'-TCCtactagtagcggccgctgcagCTACTCCGCGGAGG, Gluc1C Primers 5'-TCCgaattcgcggccgcttctagATGAGCGAGAACACG and 5'-TCCtactagtagcggccgctgcagTTAGAACCCGTTCTTG, E1 Primers 5'-TCCgaattcgcggccgcttctagATGCCTCGCGCTCT and 5'-TCCtactagtagcggccgctgcagCTAGGTGGGAGTTGGG, G12 Primers 5'-TCCgaattcgcggccgcttctagATGTTAGTGTTAAGAGCC and 5'-TCCtactagtagcggccgctgcagCTACGACGAAGTAGG

Purified pSB1C3 plasmid and the amplified Endo5A, Gluc1C, E1, G12 constructs were digested with EcoRI and SpeI restriction enzymes. The plasmid digests were purified by agarose gel purification, while PCR product digests were purified by PCR purification. Purified digests were ligated using T4 ligase and the ligation mixes were then transformed in chemically competent DH5α E. coli.

Transformed colonies were then plated on LB-CM plate and the isolated colonies were selected and grown overnight in LB-CM media. Recombinant plasmid was isolated and sent for Sanger sequencing for confirmation.

pTAC was amplified from Bba_K868400 part using HF phusion PCR with the following primers to add the rbs (part Bba_B0034): Forward: GTTTCTTCGAATTCGCGGCCGCTTCTAGAgagctgttgacaatta Reverse: GTTTCTTCCTGCAGCGGCCGCTACTAGT tttctcctcttt aattgttatccgctca

The amplified pTAC and rbs part was then digested with EcoRI and SpeI restriction enzymes. pSB1C3 high copy assembly plasmid with the gene insert was digested using EcoRI and XbaI restriction enzymes. The plasmid digest was then purified by agarose gel purification while the pTAC RBS digest was purified by PCR purificationt. Both purified digest were ligated together using standard ligation protocol and ligation mix was then transformed in chemically competent dh5a E.coli.

surface layer fusion protein extraction

10 mL tubes of PYE-CM were inoculated with the different C. crescentus strains carrying the different cellulase fusion rsaA plasmid as well as a positive control carrying an empty rsaA plasmid and a negative control of rsaA- C. crescentus. Cultures were grown overnight at 30°C shaking. Cultures were taken out of incubator and optical density at 600 nm was measured. All cultures were then normalized to the lowest OD by diluting the remaining culture with PYE.

Low pH extraction (Walker et al. 1992) was performed using different pHs of HEPES buffer to remove only crystalline s-layer without lysing cells. Proteins were then stored in epindorf tubes at -20°C to be used at a later date.

Surface layer fusion protein expression confirmation

Caulobacter Cellulase Activity Analysis

For cellulase enzyme activity measurement, triplicate 5mL PYE-CM starter cultures were grown at 30°C in 10 mL tubes shaking for 2 days. Cultures were taken out of incubator and optical density at 600 nm was measured. All cultures were then normalized to the lowest OD 600 nm by diluting the remaining culture with PYE. 1 mL of each sample was removed and washed 3 times with fresh PYE to remove and lysed cells that may interfere with cellulase activity results.

Two separate conditions were tested using the Cellulase Activity Assay Protocol adopted from (): one with washed cells and the other with unwashed cells (all samples had been normalized previously). 150 uL of culture from the two separate conditions were aliquoted into a clear 96 well plate then 150 uL assay mix (0.1 mg/ml DNPC in xx M pH 5.5 potassium acetate buffer) was added into the each occupied well.

OD 400 nm was measured every 30 minutes for 5 hours by an XX plate reader. Between measurements the culture was incubating at 30°C.

Growth of Caulobacter displaying cellulases on cellobiose and cellulose as sole carbon sources

Results

References