Difference between revisions of "Team:DTU-Denmark/Notebook"
TrineBladt (Talk | contribs) |
|||
| Line 59: | Line 59: | ||
--> | --> | ||
| − | <!-- | + | <!--WEEK1--> |
<div class="panel panel-default"> | <div class="panel panel-default"> | ||
<a data-toggle="collapse" href="#collapse1" aria-expanded="false" aria-controls="collapse1"> <!--change x2--> | <a data-toggle="collapse" href="#collapse1" aria-expanded="false" aria-controls="collapse1"> <!--change x2--> | ||
| Line 93: | Line 93: | ||
</div> | </div> | ||
| − | + | <!--WEEK2--> | |
| + | <div class="panel panel-default"> | ||
| + | <a data-toggle="collapse" href="#collapse2" aria-expanded="false" aria-controls="collapse2"> <!--change x2--> | ||
| + | <div class=" panel-heading" role="tab" id="heading2"> <!--change x1--> | ||
| + | <h4 class="panel-title"> | ||
| + | Week 2 (June 6 - June 12) <!-- TITLE --> | ||
| + | </h4> | ||
| + | </div> | ||
| + | </a> | ||
| + | |||
| + | <!--CONTENT--> | ||
| + | <div id="collapse2" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading2"> <!-- change x2 --> | ||
| + | <div class="panel-body"> | ||
| + | <h3>Wetlab</h3> | ||
| + | |||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
| + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>Molecular Toolbox</h5> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | |||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-1 col-sm-1 col-xs-12"></div> | ||
| + | <div class="col-md-2 col-sm-2 col-xs-12"> | ||
| + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> | ||
| + | <p><em>Y. lipolytica</em> PO1f genome sequence was annotated and protospacer for targeting <em>PEX10</em> was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (<strong>bold</strong>), Protospacer (<u>underlined</u>), sgRNA (<em>italic</em>) | ||
| + | |||
| + | 5'-<strong>GGGTCGGCGCAGGTTGACGT</strong><u>GTACAAGGAGGAGCTGGAGA</u><em>GTTTTAGAGCTAGAAATAGC</em>-3' | ||
| + | |||
| + | Oligos designed to amplify a 1kb region upstream and downstream <em>PEX10</em> and anneal together by fusion PCR were also ordered from IDT.</p> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-1 col-sm-1 col-xs-12"></div> | ||
| + | <div class="col-md-2 col-sm-2 col-xs-12"> | ||
| + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> | ||
| + | <p>The <em>Y. lipolytica</em> PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the <em>SUC2</em> gene were designed. Primers were designed that amplify the functional <em>URA3</em> gene including 1 kb upstream and downstream flanking regions.</p> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-1 col-sm-1 col-xs-12"></div> | ||
| + | <div class="col-md-2 col-sm-2 col-xs-12"> | ||
| + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>pSB1A8YL</h5> | ||
| + | <p>Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into <em>Escherichia coli</em>. </p> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <!--/molecular toolbox--> | ||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
| + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>Substrates</h5> | ||
| + | <p>We did an initial experiment determining the full growth cycle of <em>Y. lipolytica</em> W29. This will be used to plan and time the following growth experiments. | ||
| + | Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening. | ||
| + | </p> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <!-- /substrate --> | ||
| + | <!-- /wetlab --> | ||
| + | |||
| + | <h3 style="clear:both;">Compute</h3> | ||
| + | |||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
| + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/d/d8/T--DTU-Denmark--modeling.png" alt=""> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <div class="grid-row"> | ||
| + | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
| + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt=""> | ||
| + | </div> | ||
| + | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
| + | <h5>Hardware</h5> | ||
| + | <p>We started building light sensors using photoresistors. Shortlisting ideas for our final project: | ||
| + | - A microtiter plate reader | ||
| + | - Hack a printer to build a membrane homogenizer | ||
| + | - Chemostat bioreactor | ||
| + | </p> | ||
| + | </div> | ||
| + | </div> <!-- /grid-row --> | ||
| + | <!-- /compute --> | ||
| + | </div> <!--/panel body--> | ||
| + | </div> <!--/collapse--> | ||
| + | </div> <!--/panel--> | ||
</div> <!-- /overview--> | </div> <!-- /overview--> | ||
Revision as of 12:22, 19 October 2016
Title
leader under the title, short introduction. Ubique moderatius efficiantur eum et, dico oporteat recusabo ius cu, pro id modus sadipscing. Maluisset patrioque eum ad, mel eius doctus accommodare eu, minimum deleniti repudiandae mel ea. Noster nostrud diceret sea no. Eos an nullam molestiae signiferumque, vel ne laudem ignota oblique. Duo te luptatum percipitur signiferumque, at dicunt iriure dolorem his.
June
Quote Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer posuere erat a ante.
Someone famous in Source Title
Week 1 (May 30 - June 5)
Wetlab
Yarowia lipolytica PO1f Δku70 was obtained from Cory M. Schwartz, cultivated and freeze stocked for future use.
Compute
Hardware
Our Arduino starter kits arrived! Make an LED blink. that’s how it begins.
Week 2 (June 6 - June 12)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Y. lipolytica PO1f genome sequence was annotated and protospacer for targeting PEX10 was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (bold), Protospacer (underlined), sgRNA (italic) 5'-GGGTCGGCGCAGGTTGACGTGTACAAGGAGGAGCTGGAGAGTTTTAGAGCTAGAAATAGC-3' Oligos designed to amplify a 1kb region upstream and downstream PEX10 and anneal together by fusion PCR were also ordered from IDT.
CRISPR-Cas9 induced URA3insertion
The Y. lipolytica PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the SUC2 gene were designed. Primers were designed that amplify the functional URA3 gene including 1 kb upstream and downstream flanking regions.
pSB1A8YL
Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into Escherichia coli.
Substrates
We did an initial experiment determining the full growth cycle of Y. lipolytica W29. This will be used to plan and time the following growth experiments. Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
Compute
Hardware
We started building light sensors using photoresistors. Shortlisting ideas for our final project: - A microtiter plate reader - Hack a printer to build a membrane homogenizer - Chemostat bioreactor
Section 2
Has ut facer debitis, quo eu agam purto. In eum justo aeterno. Sea ut atqui efficiantur, mandamus deseruisse at est, erat natum cum eu. Quot numquam in vel. Salutatus euripidis moderatius qui ex, eu tempor volumus vituperatoribus has, ius ea ullum facer corrumpit.
Section 2.1
Paragraph
Paragraph
Section 2.2
Paragraph
Paragraph
Section 2.3
Paragraph
Paragraph
Section 3
Has ut facer debitis, quo eu agam purto. In eum justo aeterno. Sea ut atqui efficiantur, mandamus deseruisse at est, erat natum cum eu. Quot numquam in vel. Salutatus euripidis moderatius qui ex, eu tempor volumus vituperatoribus has, ius ea ullum facer corrumpit.
Section 4
Has ut facer debitis, quo eu agam purto. In eum justo aeterno. Sea ut atqui efficiantur, mandamus deseruisse at est, erat natum cum eu. Quot numquam in vel. Salutatus euripidis moderatius qui ex, eu tempor volumus vituperatoribus has, ius ea ullum facer corrumpit.
Section 5
Has ut facer debitis, quo eu agam purto. In eum justo aeterno. Sea ut atqui efficiantur, mandamus deseruisse at est, erat natum cum eu. Quot numquam in vel. Salutatus euripidis moderatius qui ex, eu tempor volumus vituperatoribus has, ius ea ullum facer corrumpit.
