Difference between revisions of "Team:DTU-Denmark/Notebook"

Line 51: Line 51:
 
             </blockquote>
 
             </blockquote>
 
              
 
              
 
 
        </div> <!-- /overview-->
 
       
 
        <div><a class="anchor" id="section-2"></a>
 
        <h2 class="h2">July</h2>
 
 
 
<!--WEEK1-->
 
<!--WEEK1-->
 
    <div class="panel panel-default">
 
    <div class="panel panel-default">
Line 90: Line 83:
 
        </div>     
 
        </div>     
 
    </div>
 
    </div>
 +
 +
<!--WEEK2-->
 +
 +
  <div class="panel panel-default">
 +
        <a data-toggle="collapse" href="#collapse2" aria-expanded="false" aria-controls="collapse2"> <!--change x2-->
 +
            <div class=" panel-heading" role="tab" id="heading2"> <!--change x1-->
 +
                <h4 class="panel-title">
 +
                    Week 2 (June 6 - June 12) <!-- TITLE -->
 +
                </h4>
 +
            </div>
 +
        </a>
 +
       
 +
        <!--CONTENT-->
 +
        <div id="collapse2" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading2"> <!-- change x2 -->
 +
            <div class="panel-body">
 +
                <h3>Wetlab</h3>
 +
               
 +
                    <div class="grid-row">
 +
                        <div class="col-md-3 col-sm-3 col-xs-12">
 +
                            <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt="">
 +
                        </div>
 +
                        <div class="col-md-9 col-sm-9 col-xs-12">
 +
                            <h5>Molecular Toolbox</h5>
 +
                        </div>
 +
                    </div> <!-- /grid-row -->
 +
                   
 +
                        <div class="grid-row">
 +
                            <div class="col-md-1 col-sm-1 col-xs-12"></div>
 +
                            <div class="col-md-2 col-sm-2 col-xs-12">
 +
                                <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt="">
 +
                            </div>
 +
                            <div class="col-md-9 col-sm-9 col-xs-12">
 +
                                <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5>
 +
                                <p><em>Y. lipolytica</em> PO1f genome sequence was annotated and protospacer for targeting <em>PEX10</em> was designed and ordered from IDT.  Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (<strong>bold</strong>), Protospacer (<u>underlined</u>), sgRNA (<em>italic</em>)
 +
                               
 +
                                5'-<strong>GGGTCGGCGCAGGTTGACGT</strong><u>GTACAAGGAGGAGCTGGAGA</u><em>GTTTTAGAGCTAGAAATAGC</em>-3'
 +
                               
 +
                                Oligos designed to amplify a 1kb region upstream and downstream <em>PEX10</em> and anneal together by fusion PCR were also ordered from IDT.</p>
 +
                            </div>
 +
                        </div> <!-- /grid-row -->
 +
                        <div class="grid-row">
 +
                            <div class="col-md-1 col-sm-1 col-xs-12"></div>
 +
                            <div class="col-md-2 col-sm-2 col-xs-12">
 +
                                <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt="">
 +
                            </div>
 +
                            <div class="col-md-9 col-sm-9 col-xs-12">
 +
                                <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
 +
                                <p>The <em>Y. lipolytica</em> PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the <em>SUC2</em> gene were designed. Primers were designed that amplify the functional <em>URA3</em> gene including 1 kb upstream and downstream flanking regions.</p>
 +
                            </div>
 +
                        </div> <!-- /grid-row -->
 +
                        <div class="grid-row">
 +
                            <div class="col-md-1 col-sm-1 col-xs-12"></div>
 +
                            <div class="col-md-2 col-sm-2 col-xs-12">
 +
                                <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt="">
 +
                            </div>
 +
                            <div class="col-md-9 col-sm-9 col-xs-12">
 +
                                <h5>pSB1A8YL</h5>
 +
                                <p>Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into <em>Escherichia coli</em>. </p>
 +
                            </div>
 +
                        </div> <!-- /grid-row -->
 +
        <!--/molecular toolbox-->       
 +
                    <div class="grid-row">
 +
                        <div class="col-md-3 col-sm-3 col-xs-12">
 +
                            <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt="">
 +
                        </div>
 +
                        <div class="col-md-9 col-sm-9 col-xs-12">
 +
                            <h5>Substrates</h5>
 +
                            <p>We did an initial experiment determining the full growth cycle of <em>Y. lipolytica</em> W29. This will be used to plan and time the following growth experiments.
 +
                            Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
 +
</p>
 +
                        </div>
 +
                    </div> <!-- /grid-row -->
 +
            <!-- /substrate -->
 +
        <!-- /wetlab -->   
 +
               
 +
                <h3 style="clear:both;">Compute</h3>
 +
               
 +
                    <div class="grid-row">
 +
                        <div class="col-md-3 col-sm-3 col-xs-12">
 +
                            <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt="">
 +
                        </div>
 +
                        <div class="col-md-9 col-sm-9 col-xs-12">
 +
                            <h5>Hardware</h5>
 +
                            <p>We started building light sensors using photoresistors. Shortlisting ideas for our final project:
 +
                            - A microtiter plate reader
 +
                            - Hack a printer to build a membrane homogenizer
 +
                            - Chemostat bioreactor
 +
</p>
 +
                        </div>
 +
                    </div> <!-- /grid-row -->
 +
        <!-- /compute -->
 +
            </div> <!--/panel body-->
 +
        </div> <!--/collapse--> 
 +
    </div> <!--/panel-->
 +
 +
<!--WEEK3-->
 +
 +
<!--WEEK4-->
 +
 +
<!--WEEK5-->
 +
 +
        </div> <!-- /overview-->
 +
       
 +
        <div><a class="anchor" id="section-2"></a>
 +
        <h2 class="h2">July</h2>
 
 
 
<!--WEEK2-->
 
<!--WEEK2-->
Line 103: Line 201:
 
         <div><a class="anchor" id="section-3"></a>
 
         <div><a class="anchor" id="section-3"></a>
 
         <h2 class="h2">August</h2>
 
         <h2 class="h2">August</h2>
           
+
       
 +
<!--WEEK2-->
 +
 +
<!--WEEK3-->
 +
 +
<!--WEEK4-->
 +
 +
<!--WEEK5-->
  
 
         </div>
 
         </div>

Revision as of 13:17, 19 October 2016

New HTML template for the wiki




Bootstrap Example

Title

leader under the title, short introduction. Ubique moderatius efficiantur eum et, dico oporteat recusabo ius cu, pro id modus sadipscing. Maluisset patrioque eum ad, mel eius doctus accommodare eu, minimum deleniti repudiandae mel ea. Noster nostrud diceret sea no. Eos an nullam molestiae signiferumque, vel ne laudem ignota oblique. Duo te luptatum percipitur signiferumque, at dicunt iriure dolorem his.


June

Quote Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer posuere erat a ante.

Someone famous in Source Title

Wetlab

Yarowia lipolytica PO1f Δku70 was obtained from Cory M. Schwartz, cultivated and freeze stocked for future use.

Compute

Hardware

Our Arduino starter kits arrived! Make an LED blink. that’s how it begins.

Wetlab

Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout

Y. lipolytica PO1f genome sequence was annotated and protospacer for targeting PEX10 was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (bold), Protospacer (underlined), sgRNA (italic) 5'-GGGTCGGCGCAGGTTGACGTGTACAAGGAGGAGCTGGAGAGTTTTAGAGCTAGAAATAGC-3' Oligos designed to amplify a 1kb region upstream and downstream PEX10 and anneal together by fusion PCR were also ordered from IDT.

CRISPR-Cas9 induced URA3insertion

The Y. lipolytica PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the SUC2 gene were designed. Primers were designed that amplify the functional URA3 gene including 1 kb upstream and downstream flanking regions.

pSB1A8YL

Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into Escherichia coli.

Substrates

We did an initial experiment determining the full growth cycle of Y. lipolytica W29. This will be used to plan and time the following growth experiments. Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.

Compute

Hardware

We started building light sensors using photoresistors. Shortlisting ideas for our final project: - A microtiter plate reader - Hack a printer to build a membrane homogenizer - Chemostat bioreactor

July

August

September

October

  • FIND US AT:
Facebook Twitter
  • DTU BIOBUILDERS
  • DENMARK
  • DTU - SØLTOFTS PLADS, BYGN. 221/002
  • 2800 KGS. LYNGBY

  • E-mail:
  • dtu-biobuilders-2016@googlegroups.com
  • MAIN SPONSORS:
Lundbeck fundation DTU blue dot Lundbeck fundation Lundbeck fundation