Line 454: | Line 454: | ||
<!--WEEK6--> | <!--WEEK6--> | ||
− | + | <div class="panel panel-default"> | |
− | <a data-toggle="collapse" href="# | + | <a data-toggle="collapse" href="#collapse2" aria-expanded="false" aria-controls="collapse2"> <!--change x2--> |
− | <div class=" panel-heading" role="tab" id=" | + | <div class=" panel-heading" role="tab" id="heading2"> <!--change x1--> |
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
− | Week | + | Week 2 (June 6 - June 12) <!-- TITLE --> |
</h4> | </h4> | ||
</div> | </div> | ||
Line 464: | Line 464: | ||
<!--CONTENT--> | <!--CONTENT--> | ||
− | <div id=" | + | <div id="collapse2" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading2"> <!-- change x2 --> |
<div class="panel-body"> | <div class="panel-body"> | ||
<h3>Wetlab</h3> | <h3>Wetlab</h3> | ||
Line 484: | Line 484: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> | ||
− | <p> | + | <p><em>Y. lipolytica</em> PO1f genome sequence was annotated and protospacer for targeting <em>PEX10</em> was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (<strong>bold</strong>), Protospacer (<u>underlined</u>), sgRNA (<em>italic</em>) |
− | + | ||
− | + | 5'-<strong>GGGTCGGCGCAGGTTGACGT</strong><u>GTACAAGGAGGAGCTGGAGA</u><em>GTTTTAGAGCTAGAAATAGC</em>-3' | |
− | + | ||
+ | Oligos designed to amplify a 1kb region upstream and downstream <em>PEX10</em> and anneal together by fusion PCR were also ordered from IDT.</p> | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
Line 497: | Line 498: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> | ||
− | <p> | + | <p>The <em>Y. lipolytica</em> PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the <em>SUC2</em> gene were designed. Primers were designed that amplify the functional <em>URA3</em> gene including 1 kb upstream and downstream flanking regions.</p> |
− | + | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-1 col-sm-1 col-xs-12"></div> | <div class="col-md-1 col-sm-1 col-xs-12"></div> | ||
<div class="col-md-2 col-sm-2 col-xs-12"> | <div class="col-md-2 col-sm-2 col-xs-12"> | ||
− | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/ | + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt=""> |
</div> | </div> | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
− | <h5> | + | <h5>pSB1A8YL</h5> |
− | <p> | + | <p>Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into <em>Escherichia coli</em>. </p> |
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
− | + | <!--/molecular toolbox--> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-3 col-sm-3 col-xs-12"> | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
Line 541: | Line 518: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>Substrates</h5> | <h5>Substrates</h5> | ||
− | <p> | + | <p>We did an initial experiment determining the full growth cycle of <em>Y. lipolytica</em> W29. This will be used to plan and time the following growth experiments. |
− | + | Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening. | |
− | + | ||
</p> | </p> | ||
</div> | </div> | ||
Line 551: | Line 527: | ||
<h3 style="clear:both;">Compute</h3> | <h3 style="clear:both;">Compute</h3> | ||
+ | |||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-3 col-sm-3 col-xs-12"> | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
Line 557: | Line 534: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>Hardware</h5> | <h5>Hardware</h5> | ||
− | <p> | + | <p>We started building light sensors using photoresistors. Shortlisting ideas for our final project: |
+ | - A microtiter plate reader | ||
+ | - Hack a printer to build a membrane homogenizer | ||
+ | - Chemostat bioreactor | ||
+ | </p> | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
Line 567: | Line 548: | ||
<!--WEEK7--> | <!--WEEK7--> | ||
− | + | <div class="panel panel-default"> | |
− | <a data-toggle="collapse" href="# | + | <a data-toggle="collapse" href="#collapse2" aria-expanded="false" aria-controls="collapse2"> <!--change x2--> |
− | <div class=" panel-heading" role="tab" id=" | + | <div class=" panel-heading" role="tab" id="heading2"> <!--change x1--> |
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
− | Week | + | Week 2 (June 6 - June 12) <!-- TITLE --> |
</h4> | </h4> | ||
</div> | </div> | ||
Line 577: | Line 558: | ||
<!--CONTENT--> | <!--CONTENT--> | ||
− | <div id=" | + | <div id="collapse2" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading2"> <!-- change x2 --> |
<div class="panel-body"> | <div class="panel-body"> | ||
<h3>Wetlab</h3> | <h3>Wetlab</h3> | ||
Line 597: | Line 578: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> | ||
− | <p> | + | <p><em>Y. lipolytica</em> PO1f genome sequence was annotated and protospacer for targeting <em>PEX10</em> was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (<strong>bold</strong>), Protospacer (<u>underlined</u>), sgRNA (<em>italic</em>) |
− | + | ||
− | + | 5'-<strong>GGGTCGGCGCAGGTTGACGT</strong><u>GTACAAGGAGGAGCTGGAGA</u><em>GTTTTAGAGCTAGAAATAGC</em>-3' | |
− | + | ||
+ | Oligos designed to amplify a 1kb region upstream and downstream <em>PEX10</em> and anneal together by fusion PCR were also ordered from IDT.</p> | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
Line 610: | Line 592: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> | ||
− | <p> | + | <p>The <em>Y. lipolytica</em> PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the <em>SUC2</em> gene were designed. Primers were designed that amplify the functional <em>URA3</em> gene including 1 kb upstream and downstream flanking regions.</p> |
− | + | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-1 col-sm-1 col-xs-12"></div> | <div class="col-md-1 col-sm-1 col-xs-12"></div> | ||
<div class="col-md-2 col-sm-2 col-xs-12"> | <div class="col-md-2 col-sm-2 col-xs-12"> | ||
− | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/ | + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt=""> |
</div> | </div> | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
− | <h5> | + | <h5>pSB1A8YL</h5> |
− | <p> | + | <p>Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into <em>Escherichia coli</em>. </p> |
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> | ||
− | + | <!--/molecular toolbox--> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-3 col-sm-3 col-xs-12"> | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
Line 654: | Line 612: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>Substrates</h5> | <h5>Substrates</h5> | ||
− | <p> | + | <p>We did an initial experiment determining the full growth cycle of <em>Y. lipolytica</em> W29. This will be used to plan and time the following growth experiments. |
− | + | Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening. | |
− | + | ||
</p> | </p> | ||
</div> | </div> | ||
Line 664: | Line 621: | ||
<h3 style="clear:both;">Compute</h3> | <h3 style="clear:both;">Compute</h3> | ||
+ | |||
<div class="grid-row"> | <div class="grid-row"> | ||
<div class="col-md-3 col-sm-3 col-xs-12"> | <div class="col-md-3 col-sm-3 col-xs-12"> | ||
Line 670: | Line 628: | ||
<div class="col-md-9 col-sm-9 col-xs-12"> | <div class="col-md-9 col-sm-9 col-xs-12"> | ||
<h5>Hardware</h5> | <h5>Hardware</h5> | ||
− | <p> | + | <p>We started building light sensors using photoresistors. Shortlisting ideas for our final project: |
+ | - A microtiter plate reader | ||
+ | - Hack a printer to build a membrane homogenizer | ||
+ | - Chemostat bioreactor | ||
+ | </p> | ||
</div> | </div> | ||
</div> <!-- /grid-row --> | </div> <!-- /grid-row --> |
Revision as of 13:23, 19 October 2016
June
Quote Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer posuere erat a ante.
Someone famous in Source Title
Week 1 (May 30 - June 5)
Wetlab
Yarowia lipolytica PO1f Δku70 was obtained from Cory M. Schwartz, cultivated and freeze stocked for future use.
Compute
Hardware
Our Arduino starter kits arrived! Make an LED blink. that’s how it begins.
Week 2 (June 6 - June 12)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Y. lipolytica PO1f genome sequence was annotated and protospacer for targeting PEX10 was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (bold), Protospacer (underlined), sgRNA (italic) 5'-GGGTCGGCGCAGGTTGACGTGTACAAGGAGGAGCTGGAGAGTTTTAGAGCTAGAAATAGC-3' Oligos designed to amplify a 1kb region upstream and downstream PEX10 and anneal together by fusion PCR were also ordered from IDT.
CRISPR-Cas9 induced URA3insertion
The Y. lipolytica PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the SUC2 gene were designed. Primers were designed that amplify the functional URA3 gene including 1 kb upstream and downstream flanking regions.
pSB1A8YL
Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into Escherichia coli.
Substrates
We did an initial experiment determining the full growth cycle of Y. lipolytica W29. This will be used to plan and time the following growth experiments. Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
Compute
Hardware
We started building light sensors using photoresistors. Shortlisting ideas for our final project: - A microtiter plate reader - Hack a printer to build a membrane homogenizer - Chemostat bioreactor
Week 3 (June 13 - June 19)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Genomic DNA from Y. lipolytica PO1f Δku70 and Y. lipolytica W29 was purified. PEX10 flanking regions were successfully amplified from Y. lipolytica PO1f Δku70.
CRISPR-Cas9 induced URA3insertion
Genomic DNA from Y. lipolytica PO1f Δku70 and Y. lipolytica W29 was purified. - PCR attempts to amplify URA3 and flanks failed. - sgRNAs targeting the SUC2 gene were hybridized.
pSB1A8YL
Purified the plasmid from the transformants and use this as template for PCR, although it’s still not giving any bands.
Substrates
We did initial growth experiments on minimal media with an array of different carbon sources. This experiment was discarded due to lack of repeats and wrong vitamin solution for minimal media. Waste from canola oil production by Grønninggaard is acquired. Molasses from Dansukker sugar production is acquired.
Compute
Hardware
Exploring the Arduino IDE and all the electronic components we ordered. There is so much to learn.
Week 4 (June 20 - June 26)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced URA3insertion
PCR attempts to amplify URA3 + flanks from Y. lipolytica W29 genomic DNA failed. New primers were ordered.
pSB1A8YL
We realized that the name of the primer had been mixed up! Now that the right primers are used, we get excellent bands on our gel… Guess you have to make the stupid mistakes in the beginning? The gBlock containing the other part of the plasmid also arrived. This also gives excellent bands on the gel when amplifying it by PCR. Ran the first USER and transformed E. coli cells. The transformants were left on the bench over the weekend
Substrates
We have data from the first successful growth experiment. Starch, Xylose, Arabinose, Maltose and Lactose are not suitable for Y. lipolytica fermentation. This will be repeated next week to make sure. Waste glycerol from the industrial biodiesel producer Perstop is acquired.
Week 5 (June 27 - July 3)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Received CRISPRyl plasmid (Addgene plasmid #70007). The procedure from Addgene was followed.
CRISPR-Cas9 induced URA3insertion
Successful amplification of URA3 + flanks from Y. lipolytica W29 genomic DNA. Because of low quality of the genomic DNA, the initial PCR product was taken for further amplification. Received CRISPRyl plasmid (Addgene plasmid #70007). The procedure from Addgene was followed.
pSB1A8YL
YES, colonies! colonies were picked and used for colony PCR, but it was not successful. We’ll just have to crank on! - Colonies from the same plates were re streaked and plasmids were purified from the resulting colonies. - Restriction analysis yielded weird bands. - This week passes restreaking colonies to yield pure colonies and trying to find the correct transformants through by purifying the plasmids and subjecting it to analytical digestion. So far no luck!
Substrates
Repeated positive results with growth on glucose, glycerol, fructose, sucrose and oil. Y. lipolytica should not be able to grow on sucrose. The experiments on starch, xylose, arabinose, Maltose and Lactose are still negative for Y. lipolytica. Waste glycerol from the industrial biodiesel producer Emmelev is acquired.
Compute
Genome Scale Modeling
Planning of Genome-scale modelling strategies began, decided to attempt media optimization using phenotype phase plane, team starts to research and learn FBA for GSM.
Software
Initiation of task by designing the workflow needed to achieve the final purpose of the software. Tasks agreed upon discussion : script in python , number and format proxy of the input files needed , restriction site implementation , development GUI, gui library for python (tkinter)
Hardware
Still playing.
July
Week 2 (June 6 - June 12)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Y. lipolytica PO1f genome sequence was annotated and protospacer for targeting PEX10 was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (bold), Protospacer (underlined), sgRNA (italic) 5'-GGGTCGGCGCAGGTTGACGTGTACAAGGAGGAGCTGGAGAGTTTTAGAGCTAGAAATAGC-3' Oligos designed to amplify a 1kb region upstream and downstream PEX10 and anneal together by fusion PCR were also ordered from IDT.
CRISPR-Cas9 induced URA3insertion
The Y. lipolytica PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the SUC2 gene were designed. Primers were designed that amplify the functional URA3 gene including 1 kb upstream and downstream flanking regions.
pSB1A8YL
Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into Escherichia coli.
Substrates
We did an initial experiment determining the full growth cycle of Y. lipolytica W29. This will be used to plan and time the following growth experiments. Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
Compute
Hardware
We started building light sensors using photoresistors. Shortlisting ideas for our final project: - A microtiter plate reader - Hack a printer to build a membrane homogenizer - Chemostat bioreactor
Week 2 (June 6 - June 12)
Wetlab
Molecular Toolbox
CRISPR-Cas9 induced PEX10knockout
Y. lipolytica PO1f genome sequence was annotated and protospacer for targeting PEX10 was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (bold), Protospacer (underlined), sgRNA (italic) 5'-GGGTCGGCGCAGGTTGACGTGTACAAGGAGGAGCTGGAGAGTTTTAGAGCTAGAAATAGC-3' Oligos designed to amplify a 1kb region upstream and downstream PEX10 and anneal together by fusion PCR were also ordered from IDT.
CRISPR-Cas9 induced URA3insertion
The Y. lipolytica PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the SUC2 gene were designed. Primers were designed that amplify the functional URA3 gene including 1 kb upstream and downstream flanking regions.
pSB1A8YL
Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into Escherichia coli.
Substrates
We did an initial experiment determining the full growth cycle of Y. lipolytica W29. This will be used to plan and time the following growth experiments. Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
Compute
Hardware
We started building light sensors using photoresistors. Shortlisting ideas for our final project: - A microtiter plate reader - Hack a printer to build a membrane homogenizer - Chemostat bioreactor