Week 18th -24th July

This week we designed the strategy for cloning all the proteins that we want to test in the pCOLA vector, and at the same time make everything compatible with the phytobrick format.
The table of proteins that we are working on is the following:

How to clone using the pDUET – Golden Gate adapted plasmids

The first thing that you have to do it to codon optimise your sequence for E. coli. For that we used the IDT’s Codon Optimisation Tool (https://eu.idtdna.com/CodonOpt).
After doing the codon optimisation we checked if our sequence had any recognition site for the BpiI, BsaI and BsmBI. Those enzymes are widely used in the Phytobricks and there can therefore be no recognition size outside of the purposely designed (https://2016.igem.org/Resources/Plant_Synthetic_Biology/PhytoBricks). Correct the recognition sites using a codon usage table.

Attach the following to your optimised sequence:
To the 5’- attach a BsaI recognition site that will allow you to fit the part in the Phytobrick. The sequence must be as follows, to be able to fit in the already defined iGEM parts:

In order to be able to get a singe primer for amplifying all the different CDS after synthesis, we need to add a tail before the BsaI site that will allow us to create a universal primer.
We call this structure with the NNNNN + the BsaI site 5’ the extremity A (this will make sense later on, we promise).

When adding the extremity A to the sequence take into account that the extremity ends with a start codon, therefore eliminate the one from your CDS to get it in frame.

To the 3’- attach the His-tag and a BsaI recognition site. This will allow us to purify the protein and also fit the part in the Phytobrick.

Once again, take into account the fact that the sequence must be as follows to fit in the Phytobrick. If not designed like this the BsaI recognition site will continue to exist in our sequence after cloning and that could be a problem.
Before the BsaI 3’ recognition site, add a His-tag. Do not forget removing the STOP codon from the CDS to allow for fusion with the His-tag. This two together will create what we call the extremity C (once again, will make sense!).

The extremities A and C will permit us to clone the entire CDS + His-tag in our plasmid. Nonetheless, we might not want to clone the His-tag in the iGEM Phytobricks. In order to clone the CDS without the his-tag we will design some specific primers.

The common primers FW and RV will allow us to amplify all our CDS with the His-tag and directly clone them in our desired vector. They will also allow cloning the entire part in the Phytobricks.
The common primer FW and the CDS-specific RV will allow to clone only the CDS without the His-tag into the Phytobricks, and will also allow to attach a CBD to our proteins.
Example of primers (ignore the sequence of BsaI that has been added to the CDS sequence, it is only there because it is easier to design the primers like that in the software, they will not exist in the synthesised DNA, they will be present as TAILS. Take the STOP codons always into account!

Next, we need to design our CDB and attach to it the BsaI sites to clone it in the vector, Phytobricks and attach it to our CDS.
To the 5’- attach a BsaI recognition site that will allow you to fit the part in the Phytobrick with our gene in frame. The sequence must be as follows, to be able to fit in the already defined iGEM parts.

To the 3’- attach the His-tag and a BsaI recognition site as before. This will allow us to purify the protein and also fit the part in the Phytobrick.

Ordering of primers for golden gate and Gibson assembly

We also ordered the following primers for carrying out our strategy:
Name Sequence Scale Purification
FNS_1 GTAGTAGCTGCTATATGGTCTCAA 24 Standard desalting
FNS_2 CGATGGTCTCAAAGCTCAGT 20 Standard desalting
FNS_4 CGATGGTCTCAGGCTGAGGCTGAAGCACGGCGA 33 Standard desalting
FNS_6 CGATGGTCTCAGGCTGAGGGAGAATTCAAGAAGTTCTTAAACCA 44 Standard desalting
FNS_8 CGATGGTCTCAGGCTGACTGAATAATATCCATCGGGCG 38 Standard desalting
FNS_10 CGATGGTCTCAGGCTGAAGAGTCAAATTCAATTTTTACACCACCG 45 Standard desalting
FNS_12 CGATGGTCTCAGGCTGACTGACACAGACCGTCAATCCA 38 Standard desalting
FNS_14 CGATGGTCTCAGGCTGAAGTCAAAACAGTCATAAAACGTTCATTC 45 Standard desalting
FNS_15 GCTGACGACCGAGTCTCCGCA 21 Standard desalting
FNS_16 TACCGAAGATAGCTCATGTTATATCCCGC 29 Standard desalting
FNS_17 TTGCTCAGCGGTGGCAGCAG 20 Standard desalting
FNS_18 ATCGTATTGTACACGGCCGCAT 22 Standard desalting
FNS_19 TCGGAATCGCAGACCGATACCAGGA 25 Standard desalting
FNS_20 ATTTATGCCTCTTCCGACCATCAAGC 26 Standard desalting
FNS_21 ATGTTCGTCAGGGGGGCG 18 Standard desalting
FNS_22 TTGGGGAACTGCTTAACCTGGTAACT 26 Standard desalting
FNS_23 GTGAAAAGAAAAACCACCCTGGCG 24 Standard desalting
FNS_24 GTAATTCAGCTCCGCCATCGCC 22 Standard desalting
FNS_25 GACGCGCCGAGACAGAACTT 20 Standard desalting
FNS_26 CATGTTAGTCATGCCCCGCG 20 Standard desalting

Week 25th -31th July

This week we started the kombucha growing for the Imperial Protocol reproduction. We are redoing the protocol from their 2014 team to test for the binding of the Cellulose Binding Domains that we are using.

We are carrying out a similar protocol to the one we can find at https://2014.igem.org/Team:Imperial/Protocols
Such experiment aims to measure the affinity of the CBD to the cellulose after several washes with different solutions. The affinity is measured by reading the fluorescence of the Green Fluorescent Protein, GFP, fused with the CBD. The difference between the fluorescence before and after the washes can give a reference of the affinity of the Cellulose Binding Domain under different conditions of media.
We are also testing more washing solutions, such toluene and grape extract in addition to those tested by the Imperial College iGEM team, since they are more related with our future experiments.

This experiment aims to improve the available data regarding the part BBa_K1321357, submitted by iGEM imperial College team in 2014, and also to generate data and compare affinity of the GFP-CBD and the future proteins that we will fuse with CBD in our project.

Kombucha growing protocol

We got some old Kombucha from Juan Manuel García Arcos (iGEM team from 2014 and manager of the Open Science School).

We grew the kombucha as it follows:
800mL of ddH2O heated up
Add 100g of brown sugar and let dissolve
Add 3 sachets of green tea and let them infuse until it cools down (under 30ºC!)
Add 100mL of cider vinegar
Add 200mL of starter culture (comercial kombucha in juice)
Add a big piece of kombucha culture

Grow at 30ºC without shacking!

Preparation of the crude lysate for phusion protein assays

The first thing was to grow a 20ml inocule of the strain carrying the GFP-CBD protein, in our case it was the strain FS_S2, which is transformed with the part BBa_K1321357, submitted by the Imperial College team in 2014. Chloramphenicol (Crm) was added, since the plasmid carrying this part has Cm resistance.
Following we used the 20ml of such preculture as inocule of 1L of media, and let them grow overnight.
The cells grown overnight were collected by centrifuging at 4000rpm during 20min. They were then resuspended in 10ml of PBS, and collected again to remove all the residual media.
The remaining cells were resusended in B-PER Bacterial Protein Extraction Reagent, from Thermo Scientific. 4ml per gram of cells.
Icubated for 15mins and centrifuged 5minuetes at 15000rpm.
The supernatant was recovered and the GFP-CBD detected in it by looking at the fluorescence of the sample.
Then the cell lysates were stored at 4C until the day of the assay.

Week 1st-7th August

Preparation of the 96-well plates

The 96 wells plates where we will measure the fluorescence of the GFP-CBD have to treated with cellulose in order to retain the CBDs and carry out the experiment.
In order to do that we mixed 6.4g of pure cellulose (435236-250G, Sigma-Aldrich) in 40ml of distilled water, to fill two 96 wells plates (with black plates for fluorescence measurement). Since the cellulose is almost insoluble in water the mix has to be shaken all the time while 200ul of it are added to each well. Also, due to the high viscosity of the mix we used the pipette of 1000ul to get 200ul.
Once we had all the wells full, the plates must be dried in the incubator at 37C one over night.
200 ul of cell extract was added to each well of the 96 wells plate already treated with cellulose, also the same was done with another plate but with 200ul of cell extract 1/10 diluted.

Rows A-H, columns 1-6 --> the concentration of cell extract is the original
Rows A-H, columns 7-12 --> the concentration of cell extract is 1/10 respect the original

The plate was incubated 24hours at 4C before the assay.
We carried out the assay as follows:
Measuring absorbance with 475 exication 510 emision, when the wells were full and when the liquid is removed in each case (just in the Imperial College iGEM team is described).
3 washes were done with the following solutions: water, PBS1x, ethanol 70%, BSA 5% w/w and grape extract to a concentration of 1mg/mL.

The positioning of each of the washes in the plate is as follows:

We got the following results for the experiment:

The following table shows the comparison between our preliminary data and the one that was supplied by the Imperial team in 2014. As we can see, the results are quite different. In the case of Water and PBS, they are completely opposite from what was observed by the Imperial team, and in the case of the other solutions, they are more similar. The date shown in the graph is for remaining fluorescence after washes (relative fluorescence).
Because the results are too different and also because we need to test other subtracts, we will repeat the experiment in the future.

Weeks 8-14th and 15-21th August

On August the 11th our gBlocks finally arrived, so we could really start our work on the enzyme studies.
The first step was to clone the vector in which we will clone all of our enzymes. The vector (pCOLA-FS) is based on the pCOLA plasmid, only it only contains one T7 promoter, no cloning sites incompatible with the PhytoBricks, and also contains the lac operon under the remaining T7 promoter.
The idea of cloning the lac operon is to simplify the screening for the rightly cloned plasmids.

Gibson Assembly of the pCOLA-FS plasmid

The pCOLA-FS plasmid was assembled by Gibson Assembly from the following fragments:

• pCOLA-FS synthetic fragment This fragment is 1925bp long.
• pCOLA PCR product, amplified from primers FNS_15 and FNS_16. This fragment is 2128bp long.

The final size of the plasmid, after the Gibson Assembly is 4002bp.

For the Gibson Assembly of the pCOLA-FS itself, we calculated a molar ratio of 1:1 BackBone:insert, due to the size similarity of the two fragments, which did not justify having a 1:2 ratio. We used 100ng of the PCR fragment and 93ng of the synthetic fragment, in a total of 15uL of Gibson Assembly Mix (using New England’s Biolabs’ 2X Hifi DNA Assembly MasterMix. We incubated the mix 1h at 50ºC (protocol says to incubate it for 15min, but in our experience it works better if you incubate it for longer).
2uL of the final Gibson Assembly mix was transformed through chemical transformation to E. coli DH5alfa and plated in the corresponding antibiotics.

Golden Gate of the various pCOLA-FS plasmids

After we obtained the pCOLA-FS plasmid and checked it by sequencing, we began the cloning of the different pCOLA-FS plasmids carrying the different enzymes for testing.
For doing that, the first step was getting the fragments to clone using BsaI cloning.

The PCR reaction was carried out using ThermoFischer Phusion polymerase, because of its proofreading activity, and the PCR was carried out in a volume of 50uL (10uL 5X HF Buffer, 1uL 10mM dNTPs, 2.5uL of each primer, 2uL of the template (for 20bg), 1,5uL DMSO, 0.5uL pol and 30uL water). The PCR cycle was as follows: 98ºC 30’ – (98ºC 10’’ – 60ºC 20’’ – 72ºC 1’30’’)x33 – 72ºC 10’

After purification we run a gel to confirm the amplification:

Wells: 1.CBD – 2.pbuI_Ph – 3. bpuI – 4.tanLpI_ph – 5.tanLpI – 6.BG1_Ph – 7.BG1 – 8.xylE_Ph – 9.xylE – 10.PPO2_Ph – 11.PPO2 – 12.catA_Ph – 13.catA