Difference between revisions of "Team:Toronto/Notebook-w02-wed"
| Line 6: | Line 6: | ||
<!-- repo for this wiki: https://github.com/igemuoftATG/wiki2016 --> | <!-- repo for this wiki: https://github.com/igemuoftATG/wiki2016 --> | ||
| − | |||
| − | |||
</html> | </html> | ||
{{Toronto/head}} | {{Toronto/head}} | ||
Latest revision as of 06:57, 19 October 2016
console.js:26
Week 2: May 25, 2016
Wednesday, 5/25
●
Finalizing the wet lab budget and proposal abstract:
○
"By creating a synthetic biological sensor, we can use it as a cheap, environmentally friendly and easily scalable for detecting gold. We will build cellulose paper with GolS, a transcriptional activator that can express the reporter gene LacZ in presence of gold. The activity of the LacZ can be visualized by a colour change on the paper to purple. This device will allow for a quick, easy and affordable method of detecting gold in soil and water samples. We will also create a mobile app that will use colourimetric analysis to determine the concentration of gold in the sample via the built-in smart phone camera. Along with the mobile app, we intend on designing a pipeline to discover novel gene clusters that are homologous in function to gold resistance and gold accumulation genes to discover new genes and operons that can be used as a green approach to the mining industry. The biosensing aspects can work to replace the existing gold detection methods in the mining industry as an affordable and green synthetic biology approach."
○
Proposed/estimated wet lab budget: https://docs.google.com/spreadsheets/d/1MPdm2mD6M06dT9CbcYPBbBYGa-shz_mLt-IwD8b6O6g/edit?usp=sharing
●
Predicting the 3D structure of GolS and its variants (https://drive.google.com/folderview?id=0BwhdtcohMX_ocUNNLV9XenlSYTg&usp=sharing)
●
Decided to include the His tags on the C terminus with a TEV linker.
●
Follow up with Christian Euler regarding the Anderson promoter library
●
Asking Christian Euler to become our alternate graduate advisor (he agreed)
○
Kayla and Naveen will be gone June 23 - July 11
●
Sent out emails to Dr. Madahaven, Dr. Dias, Marc Fume, Dennis and Jordan from OG
For tomorrow:
●
Identify best promoter among pgolTS, pgolB and pges
(pgolB: cttgaccttccaacactggcaaggtccagactggcaa)
●
Design plasmids using TetO-GFP and TetO-RFP in place of pgolB-LacZ and TetO-golS.
●
Decide which golS modification to use (up to two mods, but please rank them in order of favourability)
●
Follow up with Christian regarding His-tag
