|
|
| Line 1: |
Line 1: |
| − | {{Team:DTU-Denmark/header.html}} <!-- DON'T TOUCH!!! -->
| + | <div class="panel panel-default"> |
| − | | + | <a data-toggle="collapse" href="#collapse7" aria-expanded="false" aria-controls="collapse7"> <!--change x2--> |
| − | <html lang="en">
| + | <div class=" panel- heading" role=" tab" id=" heading1"> <!-- change x7--> |
| − | <head>
| + | <h4 class="panel-title"> |
| − | <!-- Edited by Isabella 7-9-16 14:30 in sidebar - remove xs-hidden from sidebar -->
| + | Week 7 (July 11 - July 17) <!-- TITLE --> |
| − | <!-- Edited by Isabella 26-9-16-14:22 fix white space above picture, do not edit the spaces between things this create unintentional space-->
| + | </h4> |
| − | <title>Bootstrap Example</title>
| + | |
| − | <meta charset="utf-8">
| + | |
| − | <meta name="viewport" content="width=device-width, initial-scale=1">
| + | |
| − | </head>
| + | |
| − | | + | |
| − | | + | |
| − | <!-- BODY -->
| + | |
| − | <body data-spy="scroll" data-target="#scrollspy" data-offset="90">
| + | |
| − | <div class="MYbody">
| + | |
| − | | + | |
| − | <div class="masthead">
| + | |
| − | <div class="container-fluid">
| + | |
| − | <div class="row">
| + | |
| − | <div class="col-md-12 thumbnail" style="background-image:url(https://www.spring-green.com/wp-content/uploads/2015/12/Tree-that-needs-pruning1.jpg)"> <!-- EDIT style url (this should lead to an image) -->
| + | |
| − | | + | |
| − | | + | |
| − | <div class="col-md-5 col-sm-5 col-xs-12 title"> <!-- the approximate max number of characters ~ 400 --> <!-- EDIT -->
| + | |
| − | <h1>Title<p class="lead">leader under the title, short introduction. Ubique moderatius efficiantur eum et, dico oporteat recusabo ius cu, pro id modus sadipscing. Maluisset patrioque eum ad, mel eius doctus accommodare eu, minimum deleniti repudiandae mel ea. Noster nostrud diceret sea no. Eos an nullam molestiae signiferumque, vel ne laudem ignota oblique. Duo te luptatum percipitur signiferumque, at dicunt iriure dolorem his.</p></h1>
| + | |
| − | </div>
| + | |
| − | <div class="col-md-2 col-sm-2 hidden-xs space"></div>
| + | |
| − | <div class="col-md-5 col-sm-5 hidden-xs intro"> <!-- will be hidden on phones, duplicate the text to blockquote down below first section header, to show it there, when it dissapear-->
| + | |
| − | <blockquote class="blockquote-reverse"> <!-- EDIT -->
| + | |
| − | <p>Quote Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer posuere erat a ante.</p>
| + | |
| − | <small>Someone famous in <cite title="Source Title">Source Title</cite></small>
| + | |
| − | </blockquote>
| + | |
| − | </div>
| + | |
| − | </div> | + | |
| | </div> | | </div> |
| − | </div> <!-- /row --> | + | </a> |
| − | <div class="border"></div>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /masthead-->
| + | |
| − | | + | |
| − | <br>
| + | |
| − | <!-- Content -->
| + | |
| − | <div class="container">
| + | |
| − | <div class="row"> <!--Must sorround both content and sidebar-->
| + | |
| − | <div class="col-md-9 col-sm-10 colLeft"> <!-- LEFT -->
| + | |
| − | <div><a class="anchor" id="section-1"></a>
| + | |
| − | <h2 class="h2">June</h2>
| + | |
| − |
| + | |
| − | <blockquote class="visible-xs"> <!-- quote from masterhead duplicate -->
| + | |
| − | <p>Quote Lorem ipsum dolor sit amet, consectetur adipiscing elit. Integer posuere erat a ante.</p>
| + | |
| − | <small>Someone famous in <cite title="Source Title">Source Title</cite></small>
| + | |
| − | </blockquote>
| + | |
| − |
| + | |
| − | <!--WEEK1-->
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse1" aria-expanded="false" aria-controls="collapse1"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading1"> <!--change x1-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 1 (May 30 - June 5) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| | | | |
| − | <!--CONTENT-->
| + | <!--CONTENT--> |
| − | <div id=" collapse1" class="panel-collapse collapse" role="tabpanel" aria-labelledby=" heading1"> <!-- change x2 --> | + | <div id=" collapse7" class="panel-collapse collapse" role="tabpanel" aria-labelledby=" heading7"> <!-- change x2 --> |
| − | | + | |
| − | <h3>Wetlab</h3>
| + | <h3>Wetlab</h3> |
| − | <p><em>Yarowia lipolytica</em> PO1f Δ<em>ku70</em> was obtained from Cory M. Schwartz, cultivated and freeze stocked for future use. </p>
| + | |
| − |
| + | |
| | | | |
| − | <h3 style="clear:both;">Compute</h3>
| + | |
| − |
| + | <div class="col-md-3 col-sm-3 col-xs-12"> |
| − | <div class="grid-row">
| + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt=""> |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | </div> |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt="">
| + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | </div>
| + | <h5>Molecular Toolbox</h5> |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | </div> |
| − | <h5>Hardware</h5>
| + | </div> <!-- /grid-row --> |
| − | <p>Our Arduino starter kits arrived! Make an LED blink. that’s how it begins.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /compute -->
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − |
| + | |
| − | <!--WEEK2-->
| + | |
| − |
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse2" aria-expanded="false" aria-controls="collapse2"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading2"> <!--change x1-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 2 (June 6 - June 12) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| − |
| + | |
| − | <!--CONTENT-->
| + | |
| − | <div id="collapse2" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading2"> <!-- change x2 -->
| + | |
| − | <div class="panel-body">
| + | |
| − | <h3>Wetlab</h3>
| + | |
| − |
| + | |
| − | | + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12"> | + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt=""> | + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | |
| − | <h5>Molecular Toolbox</h5>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| | | | |
| − | | + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div> | + | <div class="col-md-1 col-sm-1 col-xs-12"></div> |
| − | <div class="col-md-2 col-sm-2 col-xs-12"> | + | <div class="col-md-2 col-sm-2 col-xs-12"> |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt=""> | + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5>
| + | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5> |
| − | <p><em>Y. lipolytica</em> PO1f genome sequence was annotated and protospacer for targeting <em>PEX10</em> was designed and ordered from IDT. Protospacer for Gibson Assembly with CRISPRyl plasmid (Addgene plasmid #70007) SCR1'- tRNAGly (<strong>bold</strong>), Protospacer (<u>underlined</u>), sgRNA (<em>italic</em>)
| + | <p>The assembled CRISPRyl plasmid with <em>PEX10</em> protospacers was transformed in competent <em>E. coli</em> DH5α cells. |
| − | | + | Purification of assembled CRISPRyl plasmid with Pex10 protospacers. |
| − | 5'-<strong>GGGTCGGCGCAGGTTGACGT</strong><u>GTACAAGGAGGAGCTGGAGA</u><em>GTTTTAGAGCTAGAAATAGC</em>-3'
| + | The assembled CRISPRyl plasmid with <em>PEX10</em> protospacers was digested with AvrII to test if the <em>PEX10</em> protospacer was inserted. The digestion was successful and showed no cutting by AvrII indicating correct insertion of <em>PEX10</em> protospacers. |
| − |
| + | First attempt of transformation with CRISPRyl plasmid with <em>PEX10</em> protospacers in <em>Yarowia lipolytica</em> PO1f Δ<em>ku70</em>. The transformation was unsuccessful. There was growth all over the plates. </p> |
| − | Oligos designed to amplify a 1kb region upstream and downstream <em>PEX10</em> and anneal together by fusion PCR were also ordered from IDT.</p>
| + | </div> |
| − | </div>
| + | </div> <!-- /grid-row --> |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | <div class="col-md-1 col-sm-1 col-xs-12"></div> |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | <div class="col-md-2 col-sm-2 col-xs-12"> |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt=""> |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt="">
| + | </div> |
| − | </div>
| + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5> |
| − | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
| + | <p>Confirmation of successful Gibson assembly through restriction analysis. |
| − | <p>The <em>Y. lipolytica</em> PO1f genome sequence was annotated and uploaded to Benchling for sgRNA design. sgRNAs targeting the <em>SUC2</em> gene were designed. Primers were designed that amplify the functional <em>URA3</em> gene including 1 kb upstream and downstream flanking regions.</p>
| + | First (unsuccessful) transformation of pCRISPRyl and pCRISPRyl+sgRNAs into <em>Yarowia lipolytica</em> PO1f Δ<em>ku70</em>.</p> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| − | <div class="grid-row">
| + | <!--/molecular toolbox--> |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>pSB1A8YL</h5>
| + | |
| − | <p>Ran a bunch of PCRs to amplify the pUC19 part of our plasmid, but it’s not working - nothing but smear. Tried to transform the pUC19 plasmid into <em>Escherichia coli</em>. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!--/molecular toolbox-->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Substrates</h5>
| + | |
| − | <p>We did an initial experiment determining the full growth cycle of <em>Y. lipolytica</em> W29. This will be used to plan and time the following growth experiments.
| + | |
| − | Waste glycerol from the industrial biodiesel producer DAKA is acquired for late screening.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /substrate -->
| + | |
| − | <!-- /wetlab -->
| + | |
| − |
| + | |
| − | <h3 style="clear:both;">Compute</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Hardware</h5>
| + | |
| − | <p>We started building light sensors using photoresistors. Shortlisting ideas for our final project:
| + | |
| − | - A microtiter plate reader
| + | |
| − | - Hack a printer to build a membrane homogenizer
| + | |
| − | - Chemostat bioreactor
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /compute -->
| + | |
| − | </div> <!--/panel body-->
| + | |
| − | </div> <!--/collapse-->
| + | |
| − | </div> <!--/panel-->
| + | |
| − |
| + | |
| − | <!--WEEK3-->
| + | |
| − |
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse3" aria-expanded="false" aria-controls="collapse3"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading3"> <!--change x1-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 3 (June 13 - June 19) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| − |
| + | |
| − | <!--CONTENT-->
| + | |
| − | <div id="collapse3" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading3"> <!-- change x2 -->
| + | |
| − | <div class="panel-body">
| + | |
| − | <h3>Wetlab</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Molecular Toolbox</h5>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5>
| + | |
| − | <p>Genomic DNA from <em>Y. lipolytica</em> PO1f Δ<em>ku70</em> and <em>Y. lipolytica</em> W29 was purified. <em>PEX10</em> flanking regions were successfully amplified from <em>Y. lipolytica</em> PO1f Δ<em>ku70</em>. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
| + | |
| − | <p>Genomic DNA from <em>Y. lipolytica</em> PO1f Δ<em>ku70</em> and <em>Y. lipolytica</em> W29 was purified.
| + | |
| − | - PCR attempts to amplify <em>URA3</em> and flanks failed.
| + | |
| − | - sgRNAs targeting the <em>SUC2</em> gene were hybridized.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>pSB1A8YL</h5>
| + | |
| − | <p>Purified the plasmid from the transformants and use this as template for PCR, although it’s still not giving any bands.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!--/molecular toolbox-->
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Substrates</h5>
| + | |
| − | <p>We did initial growth experiments on minimal media with an array of different carbon sources. This experiment was discarded due to lack of repeats and wrong vitamin solution for minimal media.
| + | |
| − | Waste from canola oil production by Grønninggaard is acquired. Molasses from Dansukker sugar production is acquired. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /substrate -->
| + | |
| − | <!-- /wetlab -->
| + | |
| − |
| + | |
| − | <h3 style="clear:both;">Compute</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/d/d8/T--DTU-Denmark--modeling.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Hardware</h5>
| + | |
| − | <p>Exploring the Arduino IDE and all the electronic components we ordered. There is so much to learn.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /compute -->
| + | |
| − | </div> <!--/panel body-->
| + | |
| − | </div> <!--/collapse-->
| + | |
| − | </div> <!--/panel-->
| + | |
| − |
| + | |
| − | <!--WEEK4-->
| + | |
| − |
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse4" aria-expanded="false" aria-controls="collapse4"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading4"> <!--change x1-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 4 (June 20 - June 26) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| − |
| + | |
| − | <!--CONTENT-->
| + | |
| − | <div id="collapse4" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading4"> <!-- change x2 -->
| + | |
| − | <div class="panel-body">
| + | |
| − | <h3>Wetlab</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Molecular Toolbox</h5>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
| + | |
| − | <p>PCR attempts to amplify <em>URA3</em> + flanks from <em>Y. lipolytica</em> W29 genomic DNA failed. New primers were ordered.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>pSB1A8YL</h5>
| + | |
| − | <p>We realized that the name of the primer had been mixed up! Now that the right primers are used, we get excellent bands on our gel… Guess you have to make the stupid mistakes in the beginning?
| + | |
| − | The gBlock containing the other part of the plasmid also arrived. This also gives excellent bands on the gel when amplifying it by PCR.
| + | |
| − | Ran the first USER and transformed <em>E. coli</em> cells. The transformants were left on the bench over the weekend</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!--/molecular toolbox-->
| + | |
| − | <!-- /products -->
| + | |
| − |
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Substrates</h5>
| + | |
| − | <p>We have data from the first successful growth experiment. Starch, Xylose, Arabinose, Maltose and Lactose are not suitable for <em>Y. lipolytica</em> fermentation. This will be repeated next week to make sure.
| + | |
| − | Waste glycerol from the industrial biodiesel producer Perstop is acquired.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /substrate -->
| + | |
| − | <!-- /wetlab -->
| + | |
| − | </div> <!--/panel body-->
| + | |
| − | </div> <!--/collapse-->
| + | |
| − | </div> <!--/panel-->
| + | |
| − |
| + | |
| − | <!--WEEK5-->
| + | |
| − |
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse5" aria-expanded="false" aria-controls="collapse5"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading5"> <!--change x1-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 5 (June 27 - July 3) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| − |
| + | |
| − | <!--CONTENT-->
| + | |
| − | <div id="collapse5" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading5"> <!-- change x2 -->
| + | |
| − | <div class="panel-body">
| + | |
| − | <h3>Wetlab</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Molecular Toolbox</h5>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5>
| + | |
| − | <p>Received CRISPRyl plasmid (Addgene plasmid #70007). The procedure from Addgene was followed. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
| + | |
| − | <p>Successful amplification of <em>URA3</em> + flanks from <em>Y. lipolytica</em> W29 genomic DNA. Because of low quality of the genomic DNA, the initial PCR product was taken for further amplification.
| + | |
| − | Received CRISPRyl plasmid (Addgene plasmid #70007). The procedure from Addgene was followed.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ac/T--DTU-Denmark--pSB1A8YL.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>pSB1A8YL</h5>
| + | |
| − | <p>YES, colonies! colonies were picked and used for colony PCR, but it was not successful. We’ll just have to crank on!
| + | |
| − | - Colonies from the same plates were re streaked and plasmids were purified from the resulting colonies.
| + | |
| − | - Restriction analysis yielded weird bands.
| + | |
| − | - This week passes restreaking colonies to yield pure colonies and trying to find the correct transformants through by purifying the plasmids and subjecting it to analytical digestion. So far no luck!
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!--/molecular toolbox-->
| + | |
| − | <!-- /products -->
| + | |
| − |
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Substrates</h5>
| + | |
| − | <p>Repeated positive results with growth on glucose, glycerol, fructose, sucrose and oil. <em>Y. lipolytica</em> should not be able to grow on sucrose. The experiments on starch, xylose, arabinose, Maltose and Lactose are still negative for <em>Y. lipolytica</em>.
| + | |
| − | Waste glycerol from the industrial biodiesel producer Emmelev is acquired.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /substrate -->
| + | |
| − | <!-- /wetlab -->
| + | |
| − |
| + | |
| − | <h3 style="clear:both;">Compute</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/d/d8/T--DTU-Denmark--modeling.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Genome Scale Modeling</h5>
| + | |
| − | <p>Planning of Genome-scale modelling strategies began, decided to attempt media optimization using phenotype phase plane, team starts to research and learn FBA for GSM. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/1/1f/T--DTU-Denmark--software.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Software</h5>
| + | |
| − | <p>Initiation of task by designing the workflow needed to achieve the final purpose of the software. Tasks agreed upon discussion : script in python , number and format proxy of the input files needed , restriction site implementation , development GUI, gui library for python (tkinter) </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Hardware</h5>
| + | |
| − | <p>Still playing.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!-- /compute -->
| + | |
| − | </div> <!--/panel body-->
| + | |
| − | </div> <!--/collapse-->
| + | |
| − | </div> <!--/panel-->
| + | |
| − |
| + | |
| − | </div> <!-- /overview-->
| + | |
| − |
| + | |
| − | <div><a class="anchor" id="section-2"></a>
| + | |
| − | <h2 class="h2">July</h2>
| + | |
| − |
| + | |
| − | <!--WEEK6-->
| + | |
| − |
| + | |
| − | <!--WEEK7-->
| + | |
| − |
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <a data-toggle="collapse" href="#collapse7" aria-expanded="false" aria-controls="collapse7"> <!--change x2-->
| + | |
| − | <div class=" panel-heading" role="tab" id="heading1"> <!--change x7-->
| + | |
| − | <h4 class="panel-title">
| + | |
| − | Week 7 (July 11 - July 17) <!-- TITLE -->
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | </a>
| + | |
| − |
| + | |
| − | <!--CONTENT-->
| + | |
| − | <div id="collapse7" class="panel-collapse collapse" role="tabpanel" aria-labelledby="heading7"> <!-- change x2 -->
| + | |
| − | <div class="panel-body">
| + | |
| − | <h3>Wetlab</h3>
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12">
| + | |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/a/ae/T--DTU-Denmark--moleculartools.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>Molecular Toolbox</h5>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − |
| + | |
| − | <div class="grid-row">
| + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div>
| + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12">
| + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/a7/T--DTU-Denmark--pex10.png" alt="">
| + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12">
| + | |
| − | <h5>CRISPR-Cas9 induced <em>PEX10</em>knockout</h5>
| + | |
| − | <p>The assembled CRISPRyl plasmid with <em>PEX10</em> protospacers was transformed in competent <em>E. coli</em> DH5α cells. | + | |
| − | Purification of assembled CRISPRyl plasmid with Pex10 protospacers.
| + | |
| − | The assembled CRISPRyl plasmid with <em>PEX10</em> protospacers was digested with AvrII to test if the <em>PEX10</em> protospacer was inserted. The digestion was successful and showed no cutting by AvrII indicating correct insertion of <em>PEX10</em> protospacers.
| + | |
| − | First attempt of transformation with CRISPRyl plasmid with <em>PEX10</em> protospacers in <em>Yarowia lipolytica</em> PO1f Δ<em>ku70</em>. The transformation was unsuccessful. There was growth all over the plates. </p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | | + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div> | + | |
| − | <div class="col-md-2 col-sm-2 col-xs-12"> | + | |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/5/57/T--DTU-Denmark--ura3.png" alt=""> | + | |
| − | </div>
| + | |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | |
| − | <h5>CRISPR-Cas9 induced <em>URA3</em>insertion</h5>
| + | |
| − | <p>Confirmation of successful Gibson assembly through restriction analysis. | + | |
| − | First (unsuccessful) transformation of pCRISPRyl and pCRISPRyl+sgRNAs into <em>Yarowia lipolytica</em> PO1f Δ<em>ku70</em>.</p>
| + | |
| − | </div>
| + | |
| − | </div> <!-- /grid-row -->
| + | |
| − | <!--/molecular toolbox-->
| + | |
| | | | |
| − | | + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12"> | + | <div class="col-md-3 col-sm-3 col-xs-12"> |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/f/f1/T--DTU-Denmark--products.png" alt=""> | + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/f/f1/T--DTU-Denmark--products.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>Products</h5>
| + | <h5>Products</h5> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| | | | |
| − | | + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div> | + | <div class="col-md-1 col-sm-1 col-xs-12"></div> |
| − | <div class="col-md-2 col-sm-2 col-xs-12"> | + | <div class="col-md-2 col-sm-2 col-xs-12"> |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/e/e2/T--DTU-Denmark--betacarotene.png" alt=""> | + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/e/e2/T--DTU-Denmark--betacarotene.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>Beta-Carotene</h5>
| + | <h5>Beta-Carotene</h5> |
| − | <p>BioBricks BBa_K152005 (<em>crtE</em>,<em>crtI</em>,<em>crtYB</em>,<em>gfp</em>) and BBa_K530002 (<em>crtI</em>) were received from the registry. E. coli with BBa_K152005 could only grow without Ampicilin, so we suspect a problem with the AmpR backbone. We decided not to use this biobrick and instead only work with BBa_K530002, BBa_K530000 and BBa_K530001.</p> | + | <p>BioBricks BBa_K152005 (<em>crtE</em>,<em>crtI</em>,<em>crtYB</em>,<em>gfp</em>) and BBa_K530002 (<em>crtI</em>) were received from the registry. E. coli with BBa_K152005 could only grow without Ampicilin, so we suspect a problem with the AmpR backbone. We decided not to use this biobrick and instead only work with BBa_K530002, BBa_K530000 and BBa_K530001.</p> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| − | | + | |
| − | <div class="col-md-1 col-sm-1 col-xs-12"></div> | + | <div class="col-md-1 col-sm-1 col-xs-12"></div> |
| − | <div class="col-md-2 col-sm-2 col-xs-12"> | + | <div class="col-md-2 col-sm-2 col-xs-12"> |
| − | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ad/T--DTU-Denmark--proinsulin.png" alt=""> | + | <img class="lvlthree" src="https://static.igem.org/mediawiki/2016/a/ad/T--DTU-Denmark--proinsulin.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>Proinsulin</h5>
| + | <h5>Proinsulin</h5> |
| − | <p>Designing and ordering synthetic gBlock from IDT encoding TEF1, proinsulin and GFP.</p> | + | <p>Designing and ordering synthetic gBlock from IDT encoding TEF1, proinsulin and GFP.</p> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| − | <!-- /products -->
| + | <!-- /products --> |
| | | | |
| | | | |
| − | | + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12"> | + | <div class="col-md-3 col-sm-3 col-xs-12"> |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt=""> | + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/7/79/T--DTU-Denmark--substrate.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>Substrates</h5>
| + | <h5>Substrates</h5> |
| − | <p>Test shows no growth on samples of wastewater from areas contaminated with leftovers of organic molecules from fossil oil. | + | <p>Test shows no growth on samples of wastewater from areas contaminated with leftovers of organic molecules from fossil oil. |
| − | Experiments with glycerol byproduct from Emmelev biodiesel production showed to be contaminated.
| + | Experiments with glycerol byproduct from Emmelev biodiesel production showed to be contaminated. |
| − | We investigated where the contaminations could come from and a contaminated pipet seemed to be the source.
| + | We investigated where the contaminations could come from and a contaminated pipet seemed to be the source. |
| − | </p>
| + | </p> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| − | <!-- /substrate -->
| + | <!-- /substrate --> |
| − | <!-- /wetlab -->
| + | <!-- /wetlab --> |
| | | | |
| − | <h3 style="clear:both;">Compute</h3>
| + | <h3 style="clear:both;">Compute</h3> |
| − | | + | |
| − | <div class="col-md-3 col-sm-3 col-xs-12"> | + | <div class="col-md-3 col-sm-3 col-xs-12"> |
| − | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt=""> | + | <img class="lvltwo" src="https://static.igem.org/mediawiki/2016/8/8d/T--DTU-Denmark--hardware.png" alt=""> |
| − | </div>
| + | </div> |
| − | <div class="col-md-9 col-sm-9 col-xs-12"> | + | <div class="col-md-9 col-sm-9 col-xs-12"> |
| − | <h5>Hardware</h5>
| + | <h5>Hardware</h5> |
| − | <p>The library for our LCD Display is commented in Chinese. Shoutout to James for translating. Chris, our supervisor, brought us in contact with Martin and Erik, two professors from DTU Nano and Elektro. Our university is running a new project course in January where 1st semester students ferment their own cultures and build devices to monitor growth. They built a measuring chamber and a simple circuit, reading the voltage over the photodiode with a multimeter. Isn’t there a way to do all this using an Arduino? We set a meeting for next week. Reading about digital to analog conversion(DAC) and the reverse(ADC). Dimming LEDs in the office</p> | + | <p>The library for our LCD Display is commented in Chinese. Shoutout to James for translating. Chris, our supervisor, brought us in contact with Martin and Erik, two professors from DTU Nano and Elektro. Our university is running a new project course in January where 1st semester students ferment their own cultures and build devices to monitor growth. They built a measuring chamber and a simple circuit, reading the voltage over the photodiode with a multimeter. Isn’t there a way to do all this using an Arduino? We set a meeting for next week. Reading about digital to analog conversion(DAC) and the reverse(ADC). Dimming LEDs in the office</p> |
| − | </div>
| + | </div> |
| − | </div> <!-- /grid-row -->
| + | </div> <!-- /grid-row --> |
| − | <!-- /compute -->
| + | <!-- /compute --> |
| − | </div> <!--/panel body-->
| + | </div> <!--/panel body--> |
| − | </div> <!--/collapse-->
| + | </div> <!--/collapse--> |
| − | </div> <!--/panel-->
| + | </div> <!--/panel--> |
| − |
| + | |
| − | <!--WEEK8-->
| + | |
| − |
| + | |
| − | <!--WEEK9-->
| + | |
| − |
| + | |
| − | </div>
| + | |
| − |
| + | |
| − | <div><a class="anchor" id="section-3"></a>
| + | |
| − | <h2 class="h2">August</h2>
| + | |
| − |
| + | |
| − | <!--WEEK2-->
| + | |
| − |
| + | |
| − | <!--WEEK3-->
| + | |
| − |
| + | |
| − | <!--WEEK4-->
| + | |
| − |
| + | |
| − | <!--WEEK5-->
| + | |
| − | | + | |
| − | </div>
| + | |
| − | | + | |
| − | <div><a class="anchor" id="section-4"></a>
| + | |
| − | <h2 class="h2">September</h2>
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div><a class="anchor" id="section-5"></a>
| + | |
| − | <h2 class="h2">October</h2>
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | | + | |
| − | </div> <!-- /LEFT -->
| + | |
| − |
| + | |
| − | <!-- RIGHT-->
| + | |
| − | <div class="col-md-3 col-sm-2 colRight" id="scrollspy">
| + | |
| − | <ul class="nav" id="sidebar">
| + | |
| − | <li><a href="#section-1">June</a></li>
| + | |
| − | <li><a href="#section-2">July</a></li>
| + | |
| − | <li><a href="#section-3">August</a></li>
| + | |
| − | <li><a href="#section-4">September</a></li>
| + | |
| − | <li><a href="#section-5">October</a></li>
| + | |
| − | </ul>
| + | |
| − | </div> <!-- /RIGHT -->
| + | |
| − | | + | |
| − | </div> <!-- /.row -->
| + | |
| − | </div> <!-- /CONTENT-->
| + | |
| − | </div> <!-- /BODY-->
| + | |
| − | | + | |
| − | </body>
| + | |
| − | | + | |
| − | <!--script for functionality of sidebar, DON'T TOUCH!!! -->
| + | |
| − | <script type="text/javascript" src="https://2016.igem.org/Team:DTU-Denmark/sidebar-js?action=raw&ctype=text/javascript"></script>
| + | |
| − | </html>
| + | |
| − | | + | |
| − | <!-- DON'T TOUCH!!! -->
| + | |
| − | {{Team:DTU-Denmark/footer}}
| + | |
" alt="">
" alt="">
" alt="">
" alt="">
" alt="">
" alt="">
" alt="">
" alt="">
