Difference between revisions of "Team:NYMU-Taipei/Description"
Chilam Poon (Talk | contribs) |
Chilam Poon (Talk | contribs) |
||
| Line 151: | Line 151: | ||
| − | <img src=" | + | <img src="https://static.igem.org/mediawiki/parts/5/59/Bar2.png" width=”45%”> |
<p> | <p> | ||
These results showed that glufosinate ammonium affect the growth of the mycelium, but not as effectively as expected. It may be caused by the degradation of this herbicide due to the long store. | These results showed that glufosinate ammonium affect the growth of the mycelium, but not as effectively as expected. It may be caused by the degradation of this herbicide due to the long store. | ||
Revision as of 21:24, 19 October 2016
Characterization
This year we characterized and developed the part BBa_K1184000, phototoxic protein KillerRed, and a fungal selection marker gene bar BBa_K1021003.
KillerRed
We characterized this part with thermal stability assay.
KillerRed protein was extracted from transformed E.coli and a control group of empty vector was set to eliminate the influence of other proteins. This test aims to show the temperature influence on KillerRed protein by measuring its fluorescence after being treated for 2 hours at the following temperatures: 70, 70.5, 71.7, 73.5, 75.5, 78.3, 81, 83.6, 86, 88, 89.5, 92.2 (degree Celsius).
Figure1: Result of heat denaturation experiment
It is obvious that KR contribute to most of the fluorescence.
Figure2: Curve fitting of KillerRed fluorescence
A sigmoidal curve was fitted to find the particular temperature K at which half of the KR protein is denatured studied by measuring the fluorescence.
a=19.42; n=36.1; K=75.79; R-square=0.998
We also constructed a KillerRed fungal expression cassette using promoter PgpdA (BBa_K1021010) and terminator TtrpC.
The main circuit: PgpdA + KillerRed +TtrpC
We constructed this circuit on a fungal transformation vector and then transformed it into M.anisopliae via protoplast transformation.
Result:
The wild type and KillerRed transformants M.anisopliae were observed under bright field and fluroscence using Olympus BX61 Fluroscence Microscopy.
It’s obviously that there was no fluroscence for the wild type strain.
The mycelium had red fluorescence and it indicated that KillerRed protein was successfully expressed in M.anisopliae.
As we observed, the growth situations of M.anisopliae KR transformants on media will not be affected greatly since irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival in eukaryotic cells.
A SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein was designed by us (BBa_K2040122) in order to let it locate in the nucleus containing chromatin, a ROS-sensitive intracellular localization.
The selection marker barThe common fungus transformation system of entomopathogen Metarhizium anisopliae was based on resistance to the herbicide glufosinate ammonium (GA), conferred by the bar gene.
We transformed the fungal vector carrying the bar expression cassette into M. anisopliae and then cultured the bar transformants on PDA medium containing three different kinds of concentration of GA (0, 160, 1000 ug/mL) using 20ul conidia solution. Use wildtype as a control.
The initial radius were all 4mm. The mycelium length was measured on day 4, 5 and 6 after starting M.anisopliae conidia cultivation on solid media. The mycelium length was measured on the same line on each plate.
Result: The initial radius were all 4mm. The mycelium length was measured on day 4, 5 and 6 after starting M.anisopliae conidia cultivation on PDA media. The mycelium length was measured on the same line on each colony.
The higher glufosinate ammonium concentration, the more sparse the mycelium grows outward.
These results showed that glufosinate ammonium affect the growth of the mycelium, but not as effectively as expected. It may be caused by the degradation of this herbicide due to the long store.
