Difference between revisions of "Team:Concordia/Basic Part"

BBa_K2045002 CDC28: Cyclin-dependent kinase catalytic subunit
In order to have effective cell battle with our microgladiators… It was important to ensure that cell division of our nanoparticle coated cells didn’t occur. Cell division would not only make it difficult for cell isolation in our microfluidic battle dome, but it will also compromise the integrity of the cell’s nanoweaponry; since the coating of nanoparticles will be halved as the cell membrane goes through cell division. The solution was CDC28, a gene that allows users to control the growth of their cells by steadily controlled external temperature. The cells will only be active and capable of cell division at 24oC and inactive, therefore incapable of cell division, at 37oC. By attaching nanoparticles to our yeast cells with CDC28, and keeping them at 37oC in the microfluidic battle system, we can ensure an effective battle between our micro-gladiators without compromising their attached nanoweapons. Since the presence of the wild type CDC28 gene in the yeast genome would mask the phenotype of the temperature sensitive mutant we decided to knock out the wild type version of the gene using CrispR. We designed 2 primers that would amplify the T.S. CDC28 with 3 silent mutations. CrispR gRNAs were then designed to bind to the wild type sequence of the gene but were unable to bind to the newly mutated version of the T.S. CDC28 due to the 3 silent mutations. The gRNAs and the mutated T.S. CDC28 were introduced to the wild type yeast and were selected for by antibiotic resistance. Future iGEM teams will be able to use our primer and gRNA designs in order to turn wild type yeast into cell cycle temperature sensitive yeast mutants.

1- PCR amplify temperature sensitive CDC28 gene with these primers
Forward primer: 5’ caaccgttaggagcAgaCatCgttaag 3’
Reverse primer: 5’ ctttactagActGtaCtgacagtgcagtagc 3’
(silent mutations in upper case and bolded)
2-Use newly amplified T.S. CDC28 as a donor our 2 guide RNA constructs for CrispR chain reaction
gRNA1: gctgatattgttaagaagtt
gRNA2: tataatgacagtgcagtagc


To characterize this biobrick, we grew an overnight culture of the temperature-sensitive CDC28 mutant and wild-type yeast cells. After diluting the cell solutions to an optical density of 0.1, both strains were grown in SC media at 24°C and 37°C in microplates. The OD at 600nm was measured every 20 minutes for 24 hours using a Tecan Sunrise machine to create growth curves for both the wild-type and the CDC28 mutant at the two temperatures. The results clearly indicate that at the nonpermissive temperature of 37°C there is a significant difference between the growth of the wild-type and mutant. The CDC28 mutant strain stays at a low OD while the wild-type displays a typical growth curve. At the permissive temperature of 24°C, there is little difference in the pattern of growth between the two cell strains. This confirms the ability of our biobrick part to inhibit growth at a specific temperature of 37°C.