Team:UofC Calgary/Results

iGEM Calgary 2016

Results

BIOTARGET

Clonogenic Survival Assay
Results	Figure 1. Surviving fraction of cells when irradiated at 5 Gy and treated with a peptide construct or a DMSO and DTT control Figure 2. Surviving fraction of HCT116 cells when irradiated at 5 Gy and treated with ts respective peptide/control
Interpretation	The radio-protective effects of BBI on HCT 116 cells were examined using a clonogenics assay. The viability of HCT116 cells was observed using this assay. Previous literature has shown that BBI exhibits radio-protective effects on cells that have a functional P53 gene, however our results do not support this assertion. The HCT116 cell line used in our study had a functional p53 gene, however no increase in survivability was observed. The study conducted had only 1 replicate however, so more replicates need to be conducted to further verify this conclusion.
Project Achievements	No Radio-protective effects were observed in colorectal cancer cells.
Future Plans	More replicates need to be conducted in HCT116 in order to further examine the effects of BBI on cancer cell line. Another study needs to be conducted in different cell lines in order to examine the survivability effects of BBI, and whether the p53 gene is the only gene required for the radio-protective effect. A second clonogenics assay needs to be performed using primary fibroblast cells, in order to support the previous literature

Double Strand Break Assay using Immunofluorescence
Results	Figure 3: The Histology assay performed on primary fibroblast cells (1BR4) using primary mouse H2AX and rabbit 53BP1 antibody. The secondary antibody used was Alexa 488, Cy3 and DAPI. The cells were fixed at regular intervals. Only 1 replicate is shown.
Interpretation	The radio-protective effects of BBI were quantified using immunohistochemistry, where the number of DNA breaks were quantified after ionizing radiation dose and BBI administration. The radio-protective effects of oxidized or reduced peptide were examined and the graphs were plotted to analyze the differences. This experiment was conducted in order to elucidate whether the cysteine bridge present in BBI is necessary for its functioning, as a result only 2 time points (4hrs and 8hrs) were used since all the time points would have given us the same result. And it was found that there was no difference between the radio-protective effect of oxidized and reduced BBI. The number of double strand breaks repaired were fairly similar, at 4hrs and 8hrs time-point. (Note: The peptide was reduced with DDT). In order to elucidate the function and mechanism of BBI, a dosage study was also conducted with multiple IR dosage and multiple BBI concentration. The results were inconclusive however, since the inappropriate antibody was used. The staining was done using 53BP1, which is a protein that gets recruited in the later stages of the repair signal cascade, the 15-minute time point was not enough time for it to be tagged. The number of foci got capped at 25, since not all the protein was localized yet; as a result, we couldn’t detect any effect of different doses of BBI. Since our dosage study was inconclusive, and we didn’t have the resources or the time to run another assay, we used the previous literature to find the appropriate concentration. It has been shown in previous studies that 10-30uM of BBI is required for radioprotection, as a result we used 30uM for the histology assay. We found that BBI does have an effect; it reduces the number of foci in nucleus, however, only 2 replicates are conducted yet.
Project Achievements	BBI was shown to reduce DNA damage foci in primary fibroblast cells.
Future Plans	More studies need to be conducted in order to fully elucidate the mechanism and functioning of BBI using immunohistochemistry. The dosage study needs to be conducted with H2AX antibody instead of 53BP1, in order to eliminate the localization problem that occurred with 53BP1. H2AX is a phosphorylation marker, which happens quite quickly after DNA damage. The study conducted to differentiate between the two form of BBI (oxidized and reduced) can be repeated with more time points to ensure that the conclusion drawn is supported with more evidence.

DEVICE

Semipermeable Membrane Diffusion Assay
Results	Figure 1. The growth curve of Bacillus subtilis with different membranes using absorption at 260 nm over a period of time Figure 3. The growth curve of Bacillus subtilis with different membranes using absorption at 600 nm over a period of time
Interpretation	This assay was performed to determine whether the membranes used in our transdermal device would be effective in preventing bacterial cells from diffusing through. In running this diffusion assay, our data analysis showed that there was an increased amount of cell detection, meaning that the bacterial cells may or may not be diffusing through. As a result, we were not able to conclude that our membranes would be effective in acting as a filter.
Project Achievements	This does not produce any tangible benefit for our project, and another approach must be tried
Future Plans	The experiment should be repeated under aseptic conditions with a flame to ensure that there are no other sources of contamination. Also, plating the samples on chloramphenicol or hygromycin plates and adding chloramphenicol or hygromycin to the saline solution will allow us to determine whether the bacteria passing through the membrane was the one we used in our experiment. Since we got positive readings in our negative control, we decided that a better negative control would be capping off the falcon tube rather than using parafilm.

Filter Sterilization Membrane Diffusion Assay
Results	Fig 4. The left plate is the positive control using overnight cultures and without a syringe filter, the right plate is the negative control using LB media and syringe filter, and the bottom the test plate with the membrane.
Interpretation	From the results of the overnight plates, it can be concluded that the 0.2 micron syringe filter prevented the diffusion of bacteria from the syringe into the surrounding environment as no overnight cultures grew on the test plates. These were confirmed with the positive plates growing overnight cultures meaning our plates were not defective and our negative plates meaning there was no contamination.
Project Achievements	From these results, we were able to find a suitable semipermeable membrane that prevented the diffusion of bacteria cells into the surrounding environments. This helped with the applied design by creating a functional prototype.
Future Plans	The next time would be to determine if BBI can diffuse through this membrane and find a method to manufacture the 0.2 micron syringe filter for larger application in our patch design.

Backing Layer Growth Curve Assay
Results	Figure 5. The growth curve of Bacillus subtilis with limited oxygen by a backing layer using absorption at 600 nm over a period of time
Interpretation	Following chassis protocol, we are performing growth curves with the backing layer to determine if limiting the gas exchange using the backing layer will affect cell growth. The data from our experiment showed a growth curve that is similar to those found by the chassis group. Therefore, the backing layer will be a suitable material in our transdermal device since it will not limit the growth of our bacteria cells.
Project Achievements	Determined that the backing layer did not prevent cell growth and were able to find a suitable membrane for our patch design.
Future Plans	Following the first backing layer growth curve assay, we consulted our mentors and determined that the assay was not effective in determining whether our backing layer would be a limiting factor for gas exchange. This is due to the fact that there is 10x the volume of oxygen in the culture tube to begin with. Therefore, the rate of gas exchange through the backing layer will be negligible. The assay should be repeated with a different protocol to determine whether the bacterial cells can be starved of oxygen with our backing layer. In this assay we should apply the backing layer on top tightly to prevent excess oxygen in the patch. We would then put it in the shaker at 35°C + 10 rpm and take readings at day one, three and seven. This way, we will be able to gain insight on the lifetime of our patch as well.

Backing Layer Survival Assay
Results	Figure 6. The optical density of Bacillus subtilis over a 7 day period of time using different backing layer materials
Interpretation	This assay was done to determine whether the bacterial cells can be starved of oxygen with our backing layer. We can show that from day 1 to 3 there is is similar growth in the 9719, negative and positive controls. 922 had a higher initial growth rate, however this is not what we expect for a seven day trend. Our data suggests that the cells that grew, died, and then regenerated by day 7. However, there was no change in media which may mean the cell counts/OD readings on day 7 were due to dead cells.
Project Achievements	We can conclude that the backing layer has no real effect on cell growth
Future Plans	Future plans entail that we must find out if the backing layer has any detrimental effects whatsoever on cells. This may be an increased mutagenesis or whether or not the backing layer can support cells for more than 7 days.

CHASSIS

Growth Curve Experiment

Results

Fig 1. Line graph depicting OD 600nm measurement of Bacillus subtilis growth at set time points over 70 hours. Data is compiled as the average of 3 replicates of each experiment. Legend of color lines corresponds to the type of media added during growth experiment. OD600 measurements are labelled on the y-axis while time points are indicated on the x-axis.

Time (h)	Nothing (1)	Nothing (2)	Nothing (3)	LB (1)	LB (2)	LB (3)	2XLB (1)	2XLB (2)	2XLB (3)	SR (1)	SR (2)	SR (3)
0	0.02	0.02	0.04	0.04	0.01	0.02	0.06	0.05	0.07	0.26	0.2	0.05
1	0.24	0.16	0.09	0.1	0.04	0.09	0.14	0.09	0.07	0.31	0.28	0.04
2	0.15	0.02	0.01	0.11	0.03	0.04	0.42	0.21	0.23	0.53	0.41	0.2
3	0.1	0.12	0.03	0.28	0.22	0.14	0.77	0.58	0.69	0.99	0.98	0.55
4	0.12	0.13	0.01	0.61	0.46	0.45	1.19	1.01	0.89	1.13	1.53	0.95
5	0.18	0.11	0.1	1.01	1.03	1.05	1.17	1.12	1.14	1.42	1.26	1.01
6	0.11	0.05	0.11	1.33	1.17	1.17	1.3	1.28	1.25	1.81	1.75	1.23
7	0.19	0.14	0.22	1.34	1.27	1.34	1.39	1.47	1.54	1.92	1.87	1.39
8	0.76	0.775	0.97	0.865	0.795	1.22	1.45	1.165	1.505	1.86	1.765	1.8
9	1.68	1.64	1.65	0.05	0.04	1.18	1.38	0.93	1.51	1.7	1.61	1.51
10	1.66	1.84	1.92	0.01	0.01	1.35	1.56	1.09	1.56	1.83	1.77	1.61
11	0.79	1.96	2.32	0.04	0.03	1.36	1.58	1.22	1.63	2.88	2.45	1.63
12	1.87	2.21	2.41	0.01	0.1	1.65	1.81	1.4	1.86	2.39	2.49	1.94
13	2.82	2.74	2.69	0.03	0	1.6	1.79	1.54	1.79	2.55	2.46	1.92
14	2.44	3.09	3.13	0.06	0.03	1.89	2.04	1.81	2.11	2.43	2.89	2.35
15	2.71	3.17	3.22	0.05	0.04	1.65	2.3	2.66	2.3	2.93	2.97	2.84
16	2.335	2.8	2.895	1.01	0.675	1.805	2.32	2.065	2.4	2.815	2.71	2.5
17	2.45	2.47	2.67	2.25	1.7	1.98	2.44	1.93	2.47	2.44	3.13	2.28
18	2.78	2.85	3.02	2.36	1.82	2.12	2.41	2.34	2.75	2.82	3.89	2.54
19	2.73	2.86	2.98	2.49	1.98	2.37	2.69	2.35	2.76	2.63	3.12	2.59
20	3.08	3.23	3.26	2.63	2.08	2.36	2.87	2.44	2.99	2.4	3.36	2.75
21	3.65	3.41	3.56	2.78	2.41	2.69	2.87	2.4	2.91	3.24	3.42	2.94
22	3.83	3.73	3.79	2.92	2.12	2.65	3.1	2.66	3.195	3.37	3.8	3.17
23	3.63	3.53	3.5	3.12	2.29	2.57	3.18	2.91	3.12	3.38	3.39	3.18
24	2.98	2.26	3.02	2.33	1.955	1.31	3.045	3.1	3.31	5.245	4.615	4.85
25	1.99	1.3	2.55	2.1	1.98	1.93	2.34	2.71	2.51	4.3	4.8	2.8
26	2.3	1.57	2.6	2.34	2.09	2.11	2.39	2.75	2.45	4.5	5	2.93
27	2.39	1.63	2.83	2.39	2.26	2.23	2.75	2.86	2.43	4.7	6.1	3.4
28	2.65	1.86	2.83	3	2.46	2.45	2.76	3.23	3.02	8.6	6.5	2.95
29	2.96	2.22	2.92	3.52	2.8	2.83	2.62	3.53	3.04	5.4	6.3	3.77
30	3.13	2.26	2.89	3.22	2.64	2.78	3.02	3.42	3.28	5.9	6.9	3.71
31	3.4	2.36	3.1	3.2	2.92	2.86	3.19	3.86	3.87	5.3	7.2	4.5
32	3.045	2.465	2.16	2.365	1.955	2.57	3.15	3.18	3.14	5.9	5.9	6.1
33	2.45	2.38	2.24	1.95	1.54	2.48	3.26	2.73	3.02	3.9	4	4.95
34	2.74	2.38	2.21	2.28	1.94	2.58	3.14	2.76	2.97	4.7	6.6	5.3
35	0.236	2.22	1.98	2.58	2.11	2.34	3.31	2.88	3.08	4.4	4.7	7
36	2.23	2.11	1.96	2.78	2.59	2.51	3.39	2.81	3.06	5	4.9	8.6
37	2.16	2.04	1.02	3.17	2.73	2.66	3.3	2.79	2.82	4.1	6.9	6.3
38	2.18	2.15	1.89	2.91	2.23	2.09	2.95	2.55	2.74	5.7	4.7	7
39	2.09	2.32	1.72	3.12	2.53	2.04	3.07	3.04	3.23	4.9	6.6	5.5
40	1.775	1.795	1.845	2.58	2.39	1.925	3.265	3.075	2.885	5.15	5.2	6.245
41	2.02	2	1.93	2.09	2.08	2	3.07	3.2	3.11	3.7	4.8	3.65
42	1.99	2.21	1.97	1.99	2.04	1.88	3.25	3.4	2.39	4.4	4.8	3.76
43	2.11	2.08	1.84	2.03	2.02	1.91	3.5	3.42	3.24	5	5.9	4.1
44	1.99	2.24	1.79	1.91	1.86	1.75	3.2	3.41	3.33	4.9	5.8	2.7
45	1.93	1.91	1.83	1.97	1.86	1.8	3.69	3.33	3.02	5.8	5.8	4
46	1.69	1.9	1.7	1.62	1.61	1.58	2.9	3.03	3.15	4.1	5.5	3.9
47	1.71	1.62	1.57	1.71	1.49	1.51	3.7	3.31	3.39	6.7	6.8	5.2
48	2.17	2.225	2.02	1.965	1.6	1.45	3.21	3.465	2.865	5.15	6.7	5
49	2.7	2.88	2.53	2.48	1.61	1.5	2.68	3.01	2.83	5.6	7.6	5.3
50	2.5	2.7	2.44	2.43	1.57	1.37	2.74	2.96	3.12	5.6	7.2	5.1
51	2.34	2.49	2.24	2.34	1.54	1.41	2.68	2.91	2.79	7.1	8.5	5.7
52	2.49	2.6	2.34	2.22	1.54	1.38	2.57	2.87	2.68	6.4	7.2	7.1
53	2.15	2.28	2.28	2.14	1.55	1.46	2.58	2.83	2.89	6	7.4	8.3
54	2.2	2.28	2.21	2.15	1.52	1.43	2.62	3	3	11.6	13.5	6.9
55	2.07	2.25	2.16	2.22	1.44	1.29	2.48	2.83	2.68	12	14.2	5
56	1.87	1.89	1.795	1.885	1.69	1.055	2.605	3.3	2.865	9	9.7	3.7
57	1.73	1.7	1.72	1.85	2.02	0.88	2.65	3.52	2.83	4.7	5.1	6.7
58	1.45	1.53	1.32	1.55	2.09	0.83	2.66	3.6	3	5.2	6.2	6.6
59	1.71	1.71	1.31	1.68	2.2	0.87	2.63	3.63	2.88	5.8	6	6.7
60	1.65	1.52	1.52	1.72	2.44	0.88	2.66	3.51	3	4.8	6.9	5.2
61	1.67	1.57	1.53	1.72	2.36	0.87	3.11	3.72	3.04	4.6	8.8	4.8
62	1.64	1.54	1.48	1.62	2.01	0.77	2.84	3.75	3.14	9.6	10.7	6.6
63	1.63	1.61	1.69	1.55	2.21	0.88	2.54	3.63	3.02	9.5	9.5	6.6
64	1.455	1.41	1.515	1.2	1.45	0.82	2.415	3.465	2.26	7.8	7.35	2.05
65	1.38	1.49	1.75	0.83	0.88	0.72	2.25	5.6	1.92	5.8	4.2	4.9
66	1.35	1.46	1.52	0.83	0.85	0.87	2.22	9.8	2.01	5.7	5	2.9
67	1.19	1.37	1.51	0.89	0.9	0.83	2.09	7.5	1.83	6	4.3	3.6
68	1.21	1.2	1.48	0.87	0.9	0.85	2.13	6.7	2.16	5.1	4.2	0.8
69	1.12	1.33	1.5	1	0.98	0.81	2.76	13.5	2.04	9.7	3.8	2.5
70	1.32	1.26	1.59	0.88	0.88	0.73	2.3	2.1	2.08	10.7	8.8	1.9
71	1.18	1.25	1.52	0.81	0.8	0.87	2.21	7.4	1.88	10	8.5	5.9
72	1.16	1.2	1.47	0.99	0.91	0.97	2.4	6.3	2.26	10.6	9.5	4.5

Table 1. Raw data of the growth experiment of Bacillus subtilis by measuring growth as a function of OD 600nm readings with its respective time points.

Fig 2. Line diagram depicting the growth pattern of Bacillus subtilis when subjected to differing temperatures, using OD600nm spectrophotometry as a method to measure cell growth over time. The data points depicted in this diagram are averages of data collected over 3 replicates for each experiment, shown in Table 2. Time is modelled on the x-axis whereas OD600 is governed by the y-axis.

Time (h)	4˚C (1)	4˚C (2)	4˚C (3)	22˚C (1)	22˚C (2)	22˚C (3)	35˚C (1)	35˚C (2)	35˚C (3)
0	0.29	0.03	0.05	0.1	0.04	0.03	0.11	0.1	0.24
1	0.34	0.02	0.03	0.05	0.08	0.08	0.28	0.14	0.29
2	0.06	0	0	0.07	0.09	0.05	0.43	0.34	0.69
3	0.16	0	0	0.08	0.11	0.06	0.59	0.6	1.36
4	0.09	0.063	0.06	0.1	0.13	0.1	1.2	1.37	1.52
5	0.05	0.055	0.119	0.14	0.19	0.18	1.71	1.82	1.82
6	0.02	0.059	0.071	0.2	0.3	0.25	1.96	1.52	1.99
7	0.14	0.064	0.064	0.36	0.5	0.37	2.17	2.18	2.28
8	0.4	0.058	0.07	0.47	0.595	0.575	3.08	2.005	2.655
9	0.31	0	0	0.89	0.76	0.98	2.93	2.22	2.46
10	0.09	0	0	0.84	1.03	1.13	2.92	2.64	2.71
11	0.17	0	0.045	0.84	1.07	1.38	3.74	2.93	2.75
12	0.05	0.039	0.042	1	1.46	1.54	3.92	3.16	3.34
13	0.01	0.038	0.038	0.93	1.74	1.92	3.95	3.46	3.51
14	0	0.043	0.04	1.08	2.08	2.06	4.27	3.67	3.68
15	0.09	0.042	0.046	1.2	1.93	2.27	3.94	3.97	4.2
16	0.285	0.037	0.041	1.48	2.545	2.48	3.84	3.95	3.83
17	0.29	0	0	1.84	2.76	2.96	3.84	3.47	3.96
18	0.06	0	0	1.6	2.95	2.78	3.9	3.71	4.5
19	0.06	0.049	0.039	1.67	3.25	2.95	3.76	3.64	3.8
20	0.01	0.032	0.032	1.76	3.33	3.11	3.68	3.55	4.16
21	0	0.033	0.033	1.82	3.26	3.17	3.79	3.25	3.49
22	0	0.041	0.037	2.01	3.55	3.24	3.44	3.7	3.45
23	0.06	0.038	0.039	1.71	3.63	3.32	3.35	3.46	3.15
24	0.03	0.034	0.043	2.05	3.59	3.4	3.03	3.35	3.5

Table 2. Raw OD 600nm data of Bacillus subtilis growth curve experiment as described in the protocol available on the wiki. Differing temperature and time controls are indicated.

Interpretation

In regards to the media addition growth experiment, there are several points in which it would be important to address. There was little difference between the addition of LB and the control of no media addition. This is an unexpected result, as one would expect the nutrient in the media to be used over time by the cells and need to be replaced by the addition of new media; no further media added was expected to slow down growth of the bacteria. However, it seems as though this effect was minimal and that the addition of LB proved to have little effect on the growth of the cells. Another interesting feature of this experiment was that the addition of super rich (SR) far surpassed all other media addition treatments. For example at the final time point (70-hour), the SR treatment had an OD600nm average of 8.2 whereas the closest treatment (being the 2-times concentrated LB media) had only an OD600nm average of 3.65. This is a clear indication that the SR media has the nutrient concentration most ideally suited for B. subtilis growth, and would be a suitable candidate for use in our patch.

There are several conclusions which can be drawn from the temperature growth curve experiment. One, that at the ambient temperature of the international space station (22C), B. subtilis grows to a similar OD600 as the ambient skin temperature (35C) nearing the 24-hour mark. However, it grows much slower before the end of the experiment; at the 10-hour mark the OD600 average of the 22C treatment was 1.00 whereas the OD 600 average of the 35C treatment was 2.76. This is an interesting phenomenon, as it is likely that by the 24-hour time point the 35C treatment cells had used up most of the nutrient in their media, and this slowed growth immensely. On the other hand, the 22C cells had not grown near as much as the 35C cells as such would likely still have much of their nutrient in media still remaining. This is most likely the reason as to why these data points seem to converge at the 24-hour time point. The 4C treatment was always far below the other temperature treatments, never reaching over 0.4 OD600. This suggests that at 35C, the cells will be able to grow at their optimal (from what we determined), and as such our skin should suffice to keep the cells warm enough to grow properly.

Project Achievements

Found that the temperature of 35C (skin temp) is a good temperature to grow B. subtilis at, while super rich media is the best media to use for growth.

Future Plans

None. Complete!

Transformation and Isolation of pSB1c3 containing BBI-5 GFP in E. coli TOP 10
Results	Fig 3. Photograph of TOP10 E. coli colonies on petri dishes transformed with (left plates) and without (right plate) pSB1c3 GFP-BBI5 when viewed under UV light. Fig 4. 1% agarose gel electrophoresis to confirm ligation of BBI-GFP constructs in E. coli chassis. Lanes: 1. 1 Kb Plus GeneRuler DNA Ladder, 2. pMLK83 digested with Xba1 3. pSG1154 digested with EcoR1, 4. pSB1c3-RFP digested with EcoR1, 5. pSB1c3-BBIGFP digested with EcoR1, 6. pSB3c5-152001 digested with EcoR1, 7. pMLK83 digested with EcoRI + PstI, 8. pSG1154 digested with EcoRI + PstI, 9. pSB1c3-RFP digested with EcoRI + PstI, 10. pSB1c3-BBI5GFP digested with EcoRI + Pst, 11. pSB3c5-I52001 digested with EcoRI + PstI, 12. 1 Kb Plus GeneRuler DNA ladder.
Interpretation	While subjective evidence is the least credible scientific evidence, this is a clear indication that the pSB1c3 GFP-BBI5 vector was successfully transformed into E. coli when compared to the untransformed control (right plates on Fig. 3). The transformed plate is clearly glowing with green fluorescence, whereas the untransformed plate’s E. coli colonies clearly aren’t. Interestingly, this also proves that the GFP-BBI5 fusion does not have a visible effect on the function of GFP; this is important for further tests when using the GFP-BBI5 fusion. After restriction digest and ligation of the respective plasmids with their constructs (as defined in the lanes of Fig. 3), E. coli strain TOP10 samples were transformed with the ligated products. These samples were mini-prepped to isolate the plasmids, then ran on a 1% agarose gel. This gel electrophoresis confirms several of our construct plasmids due to the expected size matching with the sizes observed on the gel (Fig.3). The unligated plasmids (the controls) all adhered to their expected sizes, for example pMLK 83 digested by Xba1 (lane 2) had an expected size of 9.9kb and ran at 9.9kb on the gel. pSG1154 digested with EcoR1 (lane 3) had an expected size of 7.6 kb and was observed at 7.6 kb on the gel. This improves the confidence with which we move forward in this experiment. Most interesting in terms of our project are the BBI constructs we made. pSB1c3-BBI5GFP (lane 5) and pSB1c3-BBI5GFP (lane 10) both show their expected sizes matching the sizes found on the gel. This suggests that our restriction digest and ligation of the BBIGFP constructs worked to insert the construct into its respective plasmid.
Project Achievements	GFP-BBI5 transformed into E. coli, and was successfully isolated as a plasmid. We can now take this pSB1c3 plasmid and transform B. subtilis with this plasmid.
Future Plans	GFP-BBI5 transformed into E. coli, and was successfully isolated as a plasmid. We can now take this pSB1c3 plasmid and transform B. subtilis with this plasmid.

Isolation of pSB1c3 containing Comk with and without Amy E homology sites in E. coli TOP 10
Results	Fig 4. 1% gel electrophoresis to confirm pSB1c3 GFP-BBI5 construct and pSB1c3 ComK construct grown in E. coli chassis. All plasmids were digested with EcoR1 and Pst1. Lanes 2 and 9 are the Plus GeneRuler DNA ladder. Lanes 4-7 are pSB1c3-GFP-BBI5 construct, lanes 11-14 are the pSB1c3 ComK construct. Fig 5. 1% gel electrophoresis to confirm pSB1c3-ComK with AmyE homology regions. Lanes: 1. GeneRuler DNA ladder. 2. Empty 3. pSB1c3 (no insert) 4. pSB1c3 with AmyE regions, digested by EcoR1 and Pst1.
Interpretation	This confirmation ensured that the digestion and ligation of GFP-BBI5 and ComK were correctly inputted into the plasmids that we needed for further transformation into Bacillus subtilis. The expected band size of pSB1c3 is 2062 bp, while GFP-BBI5’s is 933 bp and ComK’s size is 966 bp. All of these expected sizes match what is seen on the gel.
Project Achievements	This is another step in the transformation of B. subtilis with ComK
Future Plans	Now that the pSB1c3 plasmid has confirmed to have ComK ligated within it, the plasmid has also been isolated. Bacillus subtilis can now be transformed with the purified plasmid. Further, now that the ComK sites with AmyE homology sites have been confirmed as well, it is possible to transform Bacillus subtilis and then integrate the plasmid into the chromosome due to the presence of the homology sites.

Sequencing data obtained from sequencing pSB1c3 with ComK with AmyE site from E. coli TOP 10
Results	NNNNNNNNTTNNNNTATANNAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTANGATGATTTCTGGAATTCACCATAATGGGGTATATGGTTTCTGGTTATAATCCATATCAGATTGCTGAAGTTCTGGATATGGATATCCGTAGCATCTACGCGTACAAGCAACGAATCGAAAAGAGAATGGGTGGTAAAATAAACGAATTATTTATTCGTTCACATTCGGTCCAACATTGATACTCAACGACCAGCCAGAATCATACTCTGTTTATACGGGCATTTATTGAAATGTCCGTTTTTATAAATAGGCCGTCCCCTCAAGAGTAAACACCATAGTATTTAAAACCATCACACGAAAAATTCAGAAGCATTACGAAATATGAATTTACAAACAATAGTGGCATAAATGTTAACCATGTTAATTTACGTAAAGTTTTACGTTGCAACATTAAAGCCTCATTTCAATCATCATGATAAATATAAAATTAATATATATTTATGCCGTAAATACCAATATACTTAGCAAACTATGTGATCTCCATTTCGATTGATTTAGTGTTTATTGACGTATGTACTGGATTATTAACGATAATATCGAGTTCTGGCCTGAGCACCGAAAATTAATATCGGTACATAACGCCGATCTTAACGTCGTTCTGACAACGCCAGCCAGTCGATGTTTATCACTTCTACTTGAAGCTTTTCCTGATGTGGTTGCACAACAAGATTTTTTCACCAGAGTCTGGGAAGAAGAAGGTATGCGTGTGCCTACTAACACGTTATATCAGAACATATCCATTATCAGACGCGGATTTCGCGCTGTTGGTGATACTACCCACTCGCTAATTGCAACCGTGCCGAGAAGAGGATTCAAGATCCATAATGACATTAACATACAAAATCATGTAATAAACTCGTCAACAGACGCACATACACACAATGCCCCACCTGCCATAAAAGTTAATGCGGNTACAAAGAGAGCATTGGNGGCGCAAAGAATTTCAATAACAAAATCCTCAAACNNATAAANTCATCTAATNNNGTTGAGCGCATTTGTCATNGNNNNTATTCTGCN Fig 6. Sequencing data obtained from sequencing pSB1c3-ComK with AmyE site. Fig 7. Sequence comparison between the sequenced ComK gene and the expected ComK gene, showing 56.5% consensus between the sequences Fig 8. BLAST run of sequenced ComK gene displaying high consensus regions between the sequenced gene and E. coli chromosomal sequences.
Interpretation	This result was not the expected result from the sequencing information. The 56.5% consensus sequence suggests that there is little consensus between the expected and actual sequences of ComK. Furthermore, there is a high sequence homology between the sequenced gene and several parts of the E. coli chromosome. From the sequence, it appears as though chromosomal sequences from E. coli had somehow managed to make it into the pSB1c3 plasmid. There are a variety of methods unto which this result could have taken place, but the most reasonable conclusion that one can draw from this data is that a chromosomal-plasmid recombination event had taken place, adding in parts of the E. coli chromosome.
Project Achievements	This does not confirm that pSB1c3 has been isolated successfully. This would be enough to submit a part.
Future Plans	This is the end of the experiment for this particular piece, however. In the future, we would need to try to re-ligate ComK with flanking AmyE sites into the pSB1c3 plasmid and re-start the experiment, and hopefully no recombination event takes place that inserts E. coli DNA into the pSB1c3

Sequencing data obtained from sequencing pSB1c3 with ComK with AmyE site from B. subtilis WB800
Results	NANNNNNNTTNANCCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTATATTAAGAGGAGGAGATATATATAATGAATATCAAGAAGTTCGCAAAACAGGCGACAGTCCTGACCTTTACCACCGCCTCTTGGCAGGGGGGGCGACCCAGGCATTCGCTGCTTGTTCTTCTTCCCCATCTAAGCATTGTGGTAAATCATGCATTTGCGCACTGTCATATCCGGCACAATGCTTTCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACNATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTNAGTTTGTANCAGCTGCTGGGATTACNNNTGGCATGNNGACTA Fig 9. DNA nucleotide sequence results of pSB1c3 containing BBI5-GFP from B. subtilis Fig 10. Consensus analysis of the expected DNA and the actual DNA obtained from the isolation of pSB1c3 containing BBI5-GFP from B. subtilis
Interpretation	The DNA consensus sequences between the expected pSB1c3 containing BBI5-GFP and the actual was quite high, at 86.6% consensus. This means that there is a high probability that B. subtilis was in fact transformed with pSB1c3 containing BBI5-GFP.
Project Achievements	This is very significant for our project, as this suggests that B. subtilis is susceptible to our plan (modularity).
Future Plans	Next time, it would be prudent to transform B. subtilis with a plasmid containing BBI5 without the GFP tag to confirm that this, on its own, can be added to B. subtilis.

Mass Spectrometry

Interpretation

The presence of BBI fused with TD-1 was examined in the blood through mass spectrometry. The blood samples were obtained from the mice sacrificed in the prototype testing study, and three replicates were used for each time point. As mentioned in that study 3 groups were used, and this analysis follows the group that was used to examine BBI-TD1 diffusion across the skin into the blood. Previous iGEM teams have shown that TD-1 works as a transdermal tag, which assists in peptide diffusion across the skin, however, no diffusion was observed in our experiment. The mass spectrometry results were negative, and no BBI-TD1 was found in the blood plasma or blood serum of control or the experimental mice samples. The monoisotopic uncharged mass of 2577.1 was calculated for the assay and the fragment spectra (i.e. MS/MS) for the +3 and +4 charge states at m/z 859.36 and 644.77 are shown in the figure above. The results can be explained partly by protein degradation in body and partly by the hypothetical failure of TD-1 to act as a transdermal tag. Since BBI is a small peptide, it is very likely to get excreted by the kidneys, and since we don’t have constant production in the patch it can be presumed that a constant concentration was not achieved in the blood. On the other hand, it can also be presumed that TD-1 may have failed to act as a transdermal tag, so no peptide diffused through the skin.

Project Achievements

· Further characterization of BBI

· Further characterization of TD-1

Future Plans

· The study can be conducted using a different transdermal tag

· A shorter timeline can also be used instead of day-2 and day-5 blood sampling. The blood drawing can be done in few hours to avoid degradation, which can also assist in determining the pharmacokinetics of the drug.

· The study can be conducted again once the Bacillus subtilis is transformed with BBI to fully examine the functioning of the prototype.

Team:UofC Calgary/Results

Results

BIOTARGET

DEVICE

CHASSIS

Mass Spectrometry

iGEM

Latest Entries

Fully Trained!

Latest Pictures

Find us