Team:NYMU-Taipei/Project-Experiment

• Home

• Achievement

• Project
  • Background
  • Design
  • Experiment
  • Model
  • Parts
  • Characterization

• Prototype

• Human Practice
  • Silver HP
  • Gold HP

• Notebook
  • Lab Note
  • Protocol

• Biosafety

• Team
  • Attributions
  • Team
  • Official Profile
  • Collaboration

• Home
• Achievement
• Project
  • Background
  • Design
  • Experiment
  • Model
  • Parts
  • Characterization
• Prototype
• Human Practice
  • Silver HP
  • Gold HP
• Notebook
  • Lab Note
  • Protocol
• Biosafety
• Team
  • Attributions
  • Team
  • Official Profile
  • Collaboration

1) Mcl1 promoter The Mcl1 promoter region with Mcl1 mRNA 5'-untranslated region at the 5' end of the coding region was amplified using the primers PMcl1-f( ACGTCCTGCAGAATCATGCAGCGCTATGAG ) and PMcl1-r( ATAAGCGGCCGC

CATGATGGTCTAGGGAACG ) 2) KR 3) Antibiotics 4) hemolymph end