Team:BioBricks/3rd Party Check
How to Check 3rd Party Rights for your Nucleotide or Peptide on Lens.org
Disclaimer: Algorithm does not constitute legal advice and will not guarantee the absence of third part rights
To download this tutorial, click here
File:T--BioBricks--3rdParty Tutorial.xlsxSearch Potential Patents
1. Open Search Page: Open Lens.org
2. Insert Base Pairs:
Insert bases for which you want to check 3rd party rights
- e.g. sGFP (atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga)
3. Select Query Type and DB: Select your Sequence type (Nucleotide vs Protein) and run search in 2 rounds, first on Nucleotide database, then on Amino Acid db
4. Submit: Submit Search
5. Minimum Coverage Select Minimum Coverage to 90% (or maximum of results) to make sure most of your base pairs are covered
6. Minimum Similarity Select Minimum Similarity 80% (or maximum of results) to select for best matches
7. Maximum Sequence Length:
Select Maximum Sequence Length to the length of your query base pairs + a buffer of 15% as an average 90% of a claimed sequence can be protected (or minimum of results)
- e.g. sGFP has 720bp, thus limit to ~830
8. Grants, in Claims
Select Grants, in Claims
- Optional: Check for "Applications, in claims" to discover whether any patents may eventually be granted on the base pairs in question
Analyze Patents
9. Open Patents Open patents one by one and not the SEQ ID in claims
10. Open the Legal Info Tab Click on Patent Details
11. Check payment status Look in the Legal Info tab whether payments are completed as a first hint if the patent is expired or abandoned
12. Open Full Text Open the full text of the patent
13. Analyze Description on Claimed Sequence
Search for "Claims" and analyze the description of the claimed sequence matching your query to evaluate whether your query sequence is infringing the claimed sequence.
- “...with a DNA sequence having the nucleotide sequence of nucleotides 304-2037 of SEQ ID NO:1” meaning promoter 11:45 is not claimed
- “... operon is one having a DNA sequence of SEQ ID No. 1 in the Sequence Listing which is lacking in the sequence extending from 953rd base to 1160th base” meaning terminator 1053:1141 is not claimed
- “... operon is one having a DNA sequence of SEQ ID No. 1 in the Sequence Listing which is lacking in the sequence extending from 953rd base to 1160th base” meaning terminator 1053:1141 is not claimed
- “A nucleotide comprising the sequence of SEQ ID NO:1 or a functional homologue thereof having at least 95% identity with SEQ ID NO:1”
- “Isolated nucleic acid comprising a sequence that has a least 90% identity to SEQ ID NO: 1 and contains at least one substitution modification relative to SEQ ID NO: 1.
- “The isolated nucleic acid of claim 1, further comprising a fluorescent label attached to the nucleic acid.”
- Check type of claimed sequence: Since June 13 2013 only artificial sequences can be patented. Lawsuits on non-artificial patented sequences before June 13, 2013 are likely to fail
