phlFp Module
The PhlF repressible promoter, phlFp (BBa_K1899004) was chosen as one of the “triggers” in our Tristable Switch. It drives the expressions of LacI (BBa_C0012) and TetR (BBa_C0040) repressors as well as the reporter monomeric red fluorescence protein, mRFP (BBa_E1010). Since phlFp is not offered by the headquarter, forward and reverse oligos of phlFp with XbaI and PstI sticky ends were designed and ordered, which were subsequently phosphorylated and annealed.
![](https://static.igem.org/mediawiki/2016/8/80/T--Hong_Kong_HKUST--phlFp_strand.png)
Figure 1. phlFp module
Promoter, Repressor and Inducer Specification
![phlFp promoter](https://static.igem.org/mediawiki/2016/b/b7/T--Hong_Kong_HKUST--phlFp.png)
- Promoter name: phlFp (PhlF repressible promoter: BBa_K1899004)
- Length: 66 base pairs
- Sequence: 5'cgacgtacggtggaatctgattcgttaccaattgacatgatacgaaacgtaccgtatcgttaaggt3'
![phlF repressor](https://static.igem.org/mediawiki/2016/6/6e/T--Hong_Kong_HKUST--Repressor_phlF.png)
- Repressor name: PhlF (PhlF repressor)
- Part Length: 603 base pairs
- Fold of repression: 83-fold
![DAPG inducer](https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKUST--Inducer_DAPG.png)
- Inducer name: DAPG (2,4-diacetylphloroglucinol)
- Effective inducer range(μM): 0.0244-25
In Pseudomonas bacteria, PhlF represses phlfp which regulates the phlACBD operon involved in plant defence. In our project, 2,4-diacetylphloroglucinol (DAPG) was used to induce phlfp driven expressions. DAPG is an anti-fungal derivative of phloroglucinol which is synthesised by PhlD. DAPG promotes its own synthesis by preventing PhlF from repressing the phlfp promoter.
Mechanism of phlFp - PhlF - DAPG Interaction
![](https://static.igem.org/mediawiki/2016/9/9c/T--Hong_Kong_HKUST--phlF_interaction_white.png)
Figure 1. Behaviour of PhlF in the presence/absence of DAPG
In the absence of DAPG, PhlF would bind to phlFp, inhibiting transcription and thus bringing GFP expression to a halt. In the presence of DAPG, however, PhlF would lose the ability to bind to phlFp, allowing transcription to proceed, resulting GFP expression.
REFERENCE
- Nielsen, A. A., & Voigt, C. A. (2014). Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Molecular Systems Biology, 10(11), 763-763. doi:10.15252/msb.20145735
- Stanton, B. C., Siciliano, V., Ghodasara, A., Wroblewska, L., Clancy, K., Trefzer, A. C., . . . Voigt, C. A. (2014). Systematic Transfer of Prokaryotic Sensors and Circuits to Mammalian Cells. ACS Synth. Biol. ACS Synthetic Biology, 3(12), 880-891. doi:10.1021/sb5002856
- ACS Synthetic Biology, 3(12), 880-891. doi:10.1021/sb5002856
- Part:BBa_K1725040. (n.d.). Retrieved October 08, 2016, from http://parts.igem.org/Part:BBa_K1725040
- De Souza, J., Weller, D., & Raaijmakers, J. (2003). Frequency, Diversity, and Activity of 2,4-Diacetylphloroglucinol-Producing Fluorescent Pseudomonas spp. in Dutch Take-all Decline Soils. Phytopathology, 93(1), 54-63. http://dx.doi.org/10.1094/phyto.2003.93.1.54