Team:Hong Kong HKUST/pPhlF
phlFp Module
The PhlF repressible promoter, phlFp (BBa_K1899004) was chosen as one of the “triggers” in our Tristable Switch. It drives the expressions of LacI (BBa_C0012) and TetR (BBa_C0040) repressors as well as the reporter monomeric red fluorescence protein, mRFP (BBa_E1010). Since phlFp is not offered by the headquarter, forward and reverse oligos of phlFp with XbaI and PstI sticky ends were designed and ordered, which were subsequently phosphorylated and annealed.
Figure 1. phlFp module
Promoter, Repressor and Inducer Specification
- Promoter name: phlFp (PhlF repressible promoter: BBa_K1899004)
- Length: 66 base pairs
- Sequence: 5'cgacgtacggtggaatctgattcgttaccaattgacatgatacgaaacgtaccgtatcgttaaggt3'
- Repressor name: PhlF (PhlF repressor)
- Part Length: 603 base pairs
- Fold of repression: 83-fold
- Inducer name: DAPG (2,4-diacetylphloroglucinol)
- Effective inducer range(μM): 0.0244-25
In Pseudomonas bacteria, PhlF represses phlfp which regulates the phlACBD operon involved in plant defence. In our project, 2,4-diacetylphloroglucinol (DAPG) was used to induce phlfp driven expressions. DAPG is an anti-fungal derivative of phloroglucinol which is synthesised by PhlD. DAPG promotes its own synthesis by preventing PhlF from repressing the phlfp promoter.
Mechanism of phlFp - PhlF - DAPG Interaction
Figure 1. Behaviour of PhlF in the presence/absence of DAPG
In the absence of DAPG, PhlF would bind to phlFp, inhibiting transcription and thus bringing GFP expression to a halt. In the presence of DAPG, however, PhlF would lose the ability to bind to phlFp, allowing transcription to proceed, resulting GFP expression.
REFERENCE
- Nielsen, A. A., & Voigt, C. A. (2014). Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Molecular Systems Biology, 10(11), 763-763. doi:10.15252/msb.20145735
- Stanton, B. C., Siciliano, V., Ghodasara, A., Wroblewska, L., Clancy, K., Trefzer, A. C., . . . Voigt, C. A. (2014). Systematic Transfer of Prokaryotic Sensors and Circuits to Mammalian Cells. ACS Synth. Biol. ACS Synthetic Biology, 3(12), 880-891. doi:10.1021/sb5002856
- ACS Synthetic Biology, 3(12), 880-891. doi:10.1021/sb5002856
- Part:BBa_K1725040. (n.d.). Retrieved October 08, 2016, from http://parts.igem.org/Part:BBa_K1725040
- De Souza, J., Weller, D., & Raaijmakers, J. (2003). Frequency, Diversity, and Activity of 2,4-Diacetylphloroglucinol-Producing Fluorescent Pseudomonas spp. in Dutch Take-all Decline Soils. Phytopathology, 93(1), 54-63. http://dx.doi.org/10.1094/phyto.2003.93.1.54
