Difference between revisions of "Team:Hong Kong HKU/Experiments"
| Line 98: | Line 98: | ||
</div> | </div> | ||
</div> | </div> | ||
| + | </div> | ||
<div class="panel panel-transparent"> | <div class="panel panel-transparent"> | ||
<div class="panel-heading" role="tab"> | <div class="panel-heading" role="tab"> | ||
| Line 111: | Line 112: | ||
</div> | </div> | ||
</div> | </div> | ||
| − | + | </div> | |
| − | + | <div class="panel panel-transparent"> | |
| − | <div class="panel-heading"> | + | <div class="panel-heading" role="tab"> |
<h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4> | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4> | ||
</div> | </div> | ||
| − | <div id="ABTS" class="panel-collapse collapse"> | + | <div id="ABTS" class="panel-collapse collapse in"> |
<div class="panel-body"> | <div class="panel-body"> | ||
| − | + | DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 23μl buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μl 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μl H2O2 (12mM final) are added to the mixture, making the final volume to be 150μl. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer. | |
| − | + | </font></p> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
</div> | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
| − | |||
| − | |||
| − | |||
<!-- footer --> | <!-- footer --> | ||
Revision as of 18:03, 18 October 2016
Notebook
Protocol
Equal amounts of oligonucleotides are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler. The following table shows the sequence of our tetrahedral DNA nanostructure.
| Oligo Name | Sequence (5' to 3') |
|---|---|
| O1 (97nt) | CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAGTCGA GTGCTGCTGAGTA |
| O2 (67nt) | CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCACGATAGCAGACGACG |
| O3 (84nt) | TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACGCATGACGCTATCGCAGCACGACTATCGCGCG |
| O4 (84nt) | GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTCACAT |
| O5 (30nt) | ATGGCACCCAGTGGAGTTAGACCCTGATTG |
The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μl, 10μM) are loaded. For analysis by 1% agarose gel, 10μl samples (10μM) are loaded. All the gels are run at a constant voltage of 100V. GelRed is used to prestained the gels.
For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μl, 10μM) is then loaded to 12% polyacrylamide gel. The gel is run at a constant voltage of 100V. GelRed is used to prestained the gel.
For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μl, 10μM) is then loaded to 12% polyacrylamide gel. The gel is run at a constant voltage of 100V. GelRed is used to prestained the gel.
DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 23μl buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μl 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μl H2O2 (12mM final) are added to the mixture, making the final volume to be 150μl. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.
