Difference between revisions of "Team:Hong Kong HKUST/Further"
SabrinaTam (Talk | contribs) |
SabrinaTam (Talk | contribs) |
||
| Line 19: | Line 19: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td rowspan="2"><img class="img-responsive" src="https://static.igem.org/mediawiki/2016/7/73/T--Hong_Kong_HKUST--r6k_tpp_mechanism.png" style="padding:10px; width: | + | <td rowspan="2"><img class="img-responsive" src="https://static.igem.org/mediawiki/2016/7/73/T--Hong_Kong_HKUST--r6k_tpp_mechanism.png" style="padding:10px; width:150%;"></td> |
<td><img class="img-responsive" src="https://static.igem.org/mediawiki/2016/b/bc/T--Hong_Kong_HKUST--r6ktppj04450.png" style="padding:10px;"></td> | <td><img class="img-responsive" src="https://static.igem.org/mediawiki/2016/b/bc/T--Hong_Kong_HKUST--r6ktppj04450.png" style="padding:10px;"></td> | ||
</tr> | </tr> | ||
| Line 36: | Line 36: | ||
</Figp> | </Figp> | ||
| − | <br><br> | + | <br><br> |
<p>From the above figure, no significant change in copy number of plasmid (per genome) was observed upon induction by aTc. We speculate that this might due to the following 2 reasons:<br><br> | <p>From the above figure, no significant change in copy number of plasmid (per genome) was observed upon induction by aTc. We speculate that this might due to the following 2 reasons:<br><br> | ||
1. An additional sequences (see table below) located directly upstream the ptet* promoter, which might altered the promoter function, possibly result in decoupling of tetR repression to ptet* promoter. In such case the promoter was rendered constitutive as the promoter is not repressed anymore and the copy number will be be constant across different [aTc]. <br><br> | 1. An additional sequences (see table below) located directly upstream the ptet* promoter, which might altered the promoter function, possibly result in decoupling of tetR repression to ptet* promoter. In such case the promoter was rendered constitutive as the promoter is not repressed anymore and the copy number will be be constant across different [aTc]. <br><br> | ||
| − | <table border="1" style="width: | + | <table border="1" style="width:1000px"> |
<tbody> | <tbody> | ||
<tr> | <tr> | ||
Revision as of 09:20, 19 October 2016
Altering Gene expression by Changing Copy Number of Vector Plasmid
One of the major challenge of the Tristable switch is balancing gene expression levels. To achieve this goal, we target the copy number of expression vector. We exploit the natural mechanism that control R6K plasmid replication.
Pi-protein controls the initiation of DNA replication in gamma origin of R6K plasmid. By varying the amount of Pi-protein being produced through an inducible promoter (ptet*), the change in plasmid copy number can be observed using Real Time PCR. This method is being studied because it could potentially offer a linear change of gene expression.
Also this method provide alternative means to control gene expression, other than controlling gene expression through the use of promoters and ribosomal binding sites (RBS), thus expanding the degree of control over gene expression.
 |
 |
 |
|
Results
From the above figure, no significant change in copy number of plasmid (per genome) was observed upon induction by aTc. We speculate that this might due to the following 2 reasons:
1. An additional sequences (see table below) located directly upstream the ptet* promoter, which might altered the promoter function, possibly result in decoupling of tetR repression to ptet* promoter. In such case the promoter was rendered constitutive as the promoter is not repressed anymore and the copy number will be be constant across different [aTc].
| Original ptet* | ttttcagcaggacgcactgacctccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
| ADDITIONAL SEQUENCE and ptet* | CCGGGTTATCACAAAATGAGTCTTCCGGCACTATGCTTGATAATAACTCCGGTGCGAAAAGTCATTATCTATCCGGCAATGATGAAGACCTTTTATCCGGTAACTTCTTGGAATAAATGCCCGGttttcagcaggacgcactgacctccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
2. As reported by previous study, the overexpression of pir gene facilitates the formation of dimeric pi protein that conversely suppress the copy number of plasmid with gamma origin. (reference) this can be simply understood as neither too low nor too high concentration of pi protein will not increase the plasmid copy number. It is conjectured that the range of [aTc] that would actually affect the copy number is very narrow and it is, therefore, hidden in one of the 10-fold interval of the [aTc]. Our experimental setups might have only shown the lowest copy number of p(R6K)-BBa_J04450 possible.
(reference : Biochemical Investigations of Control of Replication Initiation of Plasmid R6K*)
As for p(R6K)-TPP-BBa_J04450
Conclusion
The plasmid copy number of p(R6K)-TPP-BBa_J04450 remains constant across different [aTc] while that of p(R6K)-BBa_J04450 was only elevated when induced with 10^3 uM [aTc]. in our experimental context. Pinpointing the correct range of [aTc] that affects the plasmid copy number as well as removing the additional sequence would serve as further investigation to confirm the cause for the unvarying plasmid copy number.
