Difference between revisions of "Team:FAFU-CHINA/Notebook"

Week 1 (5.16-5.22）Before the first week, we cultivated Chlamydomonas reinhardtii.We sent our reserved parts to SYSU-CHINA team and ShanghaiTechChina_B team to help them to finish project.BBa-k325903 Plate1 2LBBa-k 415023 Plate1 2PBBa-k325909 Plate1 4L BBa-k934012 Plate1 5HBBa-k934022 Plate1 5J BBa-k934026 Plate1 5LBBa-k516011 Plate1 9GBBa-k546001 Plate1 12F BBa-k584002 Plate1 13E BBa-k594001 Plate1 18IBBa-k381001 Plate1 4BBBa- E0040 Plate4 13LWe distributed questionnaires about mosquito-borne diseases in China.Week 2（5.23-5.29）We designed primers for Cry4a,Cry10a, Cry11a,Cyt1,Cyt2,EGFP genes. The genes from Bacillus thuringiensis serovar israelensis strain BRC-LLP29Name Sequence lengthCry11Aa4-In-BglII-Short-F CCATACAGTTCTAGAGAATGAATTATATGGAAGATAGT 38Cry11Aa4-In-NdeI-Short-R CGGAGCGGAATCATATCGGATTAAT 25Cry4Aa4-In-BglII-Short-F CCATACAGTTCTAGAGAATGAATCCTTATCAAAATAAA 38Cry4Aa4-In-NdeI-Short-R CGGAGCGGAATCATATTCACTCG 23Cry10Aa4-In-BglII-Short-F CCATACAGTTCTAGAGAATGAATCCATATCAAAATAAG 38Cry10Aa4-In-NdeI-Short-R CGGAGCGGAATCATATATACAGATTGA 27Cry4b-In-BglII-Short-F CCATACAGTTCTAGAGAATGTGTGAAAATAACCAA 35Cry4b-In-NdeI-Short-R CGGAGCGGAATCATATTTATTTTGA 25Cyt1-In-BglII-Short-F CCATACAGTTCTAGAGAATGGAAAATTTAAATCATTGT 38Cyt1-In-NdeI-Short-R CGGAGCGGAATCATATTTAGAGGGT 25Cyt2-In-BglII-Short-F CCATACAGTTCTAGAGAATGCACCTTAATAATTTGAAT 38Cyt2-In-NdeI-Short-R CGGAGCGGAATCATATTTATTTTATTGG 28EGFP-In-BglII-F CCATACAGTTCTAGAGAATGGTGAGCAAG 29EGFP-In-NdeI-R CGGAGCGGAATCATATCTTGTACAG 25Week 3（5.30-6.5）Molecular cloning of Cry4a,Cry4b,Cry10a, Cry11a,Cyt1,Cyt2,EGFP genes.Vector is pChlamy-3.PCR        goto cycles1 Pre-denaturation 94°C 2 min    2 Denaturation 98°C 10 sec    3 Extension 68°C 30 sec/kb 2 25~454 Final Extension 68°C 5min      template Product length ResultCry11A Bt-1 1959bp XCry4Aa Bt-1 3573bp XCry4b Bt-1 1818bp XCry10A Bt-1 2058bp XCyt1 Bt-1 780bp XCyt2 Bt-1 819bp XEGFP pK7GWF2 747bp √Analysis of Negative Result： Annealing reaction was not set.Week 4 (6.6-6.11)PCR        goto cycles1 Pre-denaturation 94°C 2 min    2 Denaturation 98°C 10 sec    3 Annealing 58℃ 30sec    4 Extension 68°C 30 sec/kb 2 25~455 Final Extension 68°C 5min          Product length ResultM Trans2K Plus DNA Ladder      1 Cry11A Bt-2 1959bp √2 Cry4Aa Bt-2 3573bp  3 Cry10A Bt-2 2058bp √4 Cry4b Bt-2 1818bp √5 Cyt1 Bt-2 780bp √6 Cyt2 Bt-2 819bp √7 Cry11A Bt-3 1959bp √（Non-specific）8 Cry4Aa Bt-3 3573bp  10 Cry10A Bt-3 2058bp √（Non-specific）9 Cry4b Bt-3 1818bp  11 Cyt1 Bt-3 780bp √（Non-specific）12 Cyt2 Bt-3 819bp √13 Cry11A Bt-4 1959bp X（Non-specific）14 Cry4Aa Bt-4 3573bp （Non-specific）16 Cry10A Bt-4 2058bp √（Non-specific）15 Cry4b Bt-4 1818bp √（Non-specific）17 Cyt1 Bt-4 780bp √（Non-specific）18 Cyt2 Bt-4 819bp √（Non-specific）M Trans2K Plus DNA Ladder      1 Cry11A Colony 1959bp X2 Cry4Aa Colony 3573bp X3 Cry4b Colony 1818bp √4 Cry10A Colony 2058bp X5 Cyt1 Colony 780bp X6 Cyt2 Colony 819bp √7 Cry11A Colony 1959bp X8 Cry4Aa Colony 3573bp X9 Cry4b Colony 1818bp X10 Cry10A Colony 2058bp X11 Cyt1 Colony 819bp √12 Cyt2 Colony 1959bp √M Trans2K Plus DNA Ladder       PCR        goto cycles1 Pre-denaturation 94°C 2 min    2 Denaturation 98°C 10 sec    3 Annealing 58℃ 30sec    4 Extension 68°C 30 sec/kb 2 25~455 Final Extension 68°C 5min        template Primer-F Primer-R Product length Result1 EGFP pK7GWF2 EGFP-In-BglII-F EGFP-In-NdeI-R 747bp √2 EGFP pK7GWF2 EGFP-In-BglII-F EGFP-In-NdeI-R 747bp √Gel Extraction    Result1 EGFP √2 EGFP √estriction enzyme digestion  enzyme template1 BglII&NdeI pChlamy-32 BglII&NdeI pChlamy-3Purification of enzyme digest productIn-Fusion10μl Total Volume2 μl 5X In-Fusion HD Enzyme Premix3μl Linearized Vector4μl Purified PCR Fragment1μl dH2O (as needed)Incubate the reaction for 15 min at 50 °C, then place on ice.Continue to the Transformation Procedure. 1 EGFP+pChlamy_32 EGFP+pChlamy_3Week 5 (6.12-6.18)On 17th June, Junhao visited the Shenzhen University and their team (SZU-China) after Synthesis Biology Meeting. PCR：Cry4a,Cry10a, Cry11a,Cyt1,Cyt2Agarose gel electrophoresisPurification of PCR product or Gel extractGel extractionDouble enzyme digest of plasmidPurification of enzyme digest productAgarose gel electrophoresisIn-fusionTransformationWeek 6 (6.19-6.25)We try to UV irradiation of Bacillus thuringiensis, We need to determine the Bacillus thuringiensis concentration.Production of summer anti-mosquito handbookWeek 7 (6.26-7.2)UV irradiation of Bacillus thuringiensis. Week 8 (7.3-7.9)UV irradiation of Bacillus thuringiensis. We completed the first edition of the handbook.Week 9 (7.10-7.16)Codon optimization of Chlamydomonas reinhardtii by synbio-techWeek 10 (7.17-7.23)Gene synthesis by synbio-techWeek 11 (7-24.7.30)Cloning of the genes with codon optimization in Chlamydomonas reinhardtii ，Vector is pChlamy-3.Week 12 (7.31-8.6)We got a chance to study at department of Health Education in Jiangxi Provincial Institute of Parasitic Disease for half a day.Week 13 (8.7-8.13)We noticed that the fluorescence value in treatment group was higher than the positive control group about JNFLS-CHINA high school team’s project. We had a talk about it by social media. To explore the potential cause, we advised them to use Flow Cytometer (FCM) to gather data. And we helped them design the protocol of experiment with details. If you are interested in the details, you can visit this link: https://2016.igem.org/Team:JNFLS_China/experiments and resultsWeek 14 (8.14-8.20)During the G20 Summit held in Hangzhou, we shared our labs with them in summer. Week 15 (8.21-8.27)We Identified the production of the clone.Transforming Chlamydomonas reinhardtii by Electroporation.Week 16 (8.28-9.3)We used confocal microscopy to observe the expression of GFP, and this transformation was negative.We participated in the CCIC (Central China iGEM Consortium) held in Zhongshan University in Guangzhou.Week 17 (9.4-9.10)Transforming Chlamydomonas reinhardtii by Electroporation again.We helped NEU-China to test the expression of tCas9-CIBN and got the accurate data about the induced concentration of arabinose.Week 18 (9.11-9.17)Week 20 (9.18-9.24)We screened the transformants of C. reinhardtii. The greens in the figure are positive for transformation.We designed the qPCR primers use of detection Cry4a,Cry10a,Cry11a,Cyt1,Cyt2 genes expression.cry4a-qPCR1-F-133 ACGACCAGATGGAGGCCAAG 20cry4a-qPCR1-R-133 TACTGGATCTGGGCCAGGGT 20cry4a-qPCR2-F-70 CCAGGACAGCCACCAGTTCA 20cry4a-qPCR2-R-70 CACGCCGATGTTCTCGTTGG 20cry10a-qPCR1-F-94 CGCAACAAGCCCATCGACAA 20cry10a-qPCR1-R-94 CCTCGCTGCTGTTGCTGAAG 20cry10a-qPCR2-F-84 TTCGGCTACGTGACCTTCCC 20cry10a-qPCR2-R-84 GGTGCCGTACAGGGTCATCA 20cry11a-qPCR1-F-85 CGAGTGGGTGGACTTCGTGA 20cry11a-qPCR1-R-85 GATGCTGAACAGGGCGTTGG 20cry11a-qPCR2-F-69 CCAACGCCCTGTTCAGCATC 20cry11a-qPCR2-R-69 ACAGCTGGCTCAGGTACCAC 20cyt1-qPCR1-F-136 ACAACGTGCTGTTCGCCATC 20cyt1-qPCR1-R-136 TTGTAGCTGGCGGAGTCCTG 20cyt1-qPCR2-F-123 AACAAGGTGCTGGAGGTGCT 20cyt1-qPCR2-R-123 GGCCTCGTTCTTCTGGGTGT 20cyt2-qPCR1-F-137 CAGACCATCGAGGTGAGCGT 20cyt2-qPCR1-R-137 GGCTCCAGGTTGGTGAAGGT 20cyt2-qPCR2-F-99 GCCTTCGAGATCACCGTGGA 20cyt2-qPCR2-R-99 CACGGTCAGGGCCTTCATCT 20egfp-qPCR1-F-64 GGCCACAAGTTCAGCGTGAG 20egfp-qPCR1-R-64 TCAGGGTCAGCTTGCCGTAG 20egfp-qPCR2-F-140 GCCGACAAGCAGAAGAACGG 20egfp-qPCR2-R-140 TAGTGGTTGTCGGGCAGCAG 20Week 21 (9.25-10.1)Week 22 (10.2-10.8)Extract RNART-PCRQPCRWeek 23 (10.9-10.15)