Louislo3412 (Talk | contribs) |
Louislo3412 (Talk | contribs) |
||
(3 intermediate revisions by the same user not shown) | |||
Line 3: | Line 3: | ||
<meta name="viewport" content="width=device-width, initial-scale=1.0"> | <meta name="viewport" content="width=device-width, initial-scale=1.0"> | ||
<style> | <style> | ||
− | + | #sideMenu | |
− | + | {display:none; /* Disable the display of the annoying side main menu*/} | |
− | + | #top_title | |
− | + | {display:none; /* Disable the annoying title*/} | |
− | + | #content | |
− | + | {padding:0px; width:90%; margin-left:5%; margin-right:5%;background-color: rgba(255,255,255,0);} | |
− | + | body | |
− | + | {margin: 0; | |
− | + | font-family: "Helvetica Neue", Helvetica, Arial, sans-serif; | |
− | + | font-size: 24px; | |
− | #content { padding:0px; width:90%; margin-left:5%; margin-right:5%;} | + | color: #333333; |
+ | background-color: #fafafa; | ||
+ | background-image:url(https://static.igem.org/mediawiki/2016/a/ae/T--Hong_Kong_HKU--Background_image.png); | ||
+ | background-position:center center; | ||
+ | background-repeat:no-repeat; | ||
+ | -moz-background-size: cover; | ||
+ | background-size: cover; | ||
+ | background-attachment:fixed;} | ||
+ | .container | ||
+ | {background-color: rgba(255,255,255,0.6); | ||
+ | padding-top:80px;} | ||
+ | p {font-size: 16px;} | ||
+ | h1,h2,h3,h4,h5,h6 {color: #282828;} | ||
+ | h1 {font-size:72px;} h2 {font-size:48px;} h3 {font-size:36px;} | ||
+ | h4 {font-size:32px;} h5 {font-size:28px;} h6 {font-size:24px;} | ||
+ | .nav-pills>li.active>a{background-color:#93d66b !important;} | ||
+ | .nav-pills>li>a:hover{background-color:#b2dd75 !important; color:#FFFFFF!important;} | ||
+ | .nav-pills>li.active>a:hover{background-color:#93d66b !important;} | ||
</style> | </style> | ||
− | + | <link href="css/bootstrap.css" rel="stylesheet" type="text/css"> | |
+ | <!-- HTML5 shim and Respond.js for IE8 support of HTML5 elements and media queries --> | ||
+ | <!-- WARNING: Respond.js doesn't work if you view the page via file:// --> | ||
+ | <!--[if lt IE 9]> | ||
+ | <script src="https://oss.maxcdn.com/html5shiv/3.7.2/html5shiv.min.js"></script> | ||
+ | <script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script> | ||
+ | <![endif]--> | ||
<head> | <head> | ||
<meta charset="utf-8"> | <meta charset="utf-8"> | ||
<meta http-equiv="X-UA-Compatible" content="IE=edge"> | <meta http-equiv="X-UA-Compatible" content="IE=edge"> | ||
<meta name="viewport" content="width=device-width, initial-scale=1"> | <meta name="viewport" content="width=device-width, initial-scale=1"> | ||
− | |||
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | <link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | ||
− | |||
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | <link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | ||
</head> | </head> | ||
− | + | </html> | |
+ | {{Hong_Kong_HKU/Header}} | ||
+ | <html> | ||
<body> | <body> | ||
− | < | + | <div class="container" align="center"> |
− | + | <h2>Project</h2> | |
− | + | <ul class="nav nav-pills"> | |
− | <div class=" | + | <li class="dropdown"> |
− | < | + | <a class="dropdown-toggle" data-toggle="dropdown" href="#">Description<span class="caret"></span></a> |
− | + | <ul class="dropdown-menu"> | |
+ | <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Inspiration">Inspiration</a></li> | ||
+ | <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Objectives">Objectives</a></li> | ||
+ | <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Progress">Progress</a></li> | ||
+ | <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Sigificances">Sigificances</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li class="active"><a data-toggle="pill" href="#">Design</a></li> | ||
+ | </ul> | ||
+ | <div class="tab-content"> | ||
+ | <div id="Design" class="tab-pane fade in active"> | ||
+ | <h3>Design</h3> | ||
+ | <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/a/af/T--Hong_Kong_HKU--StrandDisplacement.jpg" alt=""> | ||
+ | <p class="text-justify" align="left"><font size="3"> | ||
+ | Our design is a tetrahedral nanostructure for diagnostic purposes. | ||
+ | It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides. | ||
+ | The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC. | ||
+ | The details of the DNA nanostructure assembly can be found in <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Experiments">here</a>. | ||
+ | The oligo sequences are shown below:<br> | ||
+ | </font></p> | ||
+ | <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/9/91/T--Hong_Kong_HKU--TetraDesign1.png" alt=""><br> | ||
+ | <table class="table"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th style="text-align:center">Tetra forming Oligo</th> | ||
+ | <th>Sequence</th> | ||
+ | <th style="text-align:center">Size (nucleotide)</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Oligo 1</td> | ||
+ | <td>CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT<br>CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA</td> | ||
+ | <td style="text-align:center">97</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Oligo 2</td> | ||
+ | <td>CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC<br>GATAGCAGACGACG</td> | ||
+ | <td style="text-align:center">67</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Oligo 3</td> | ||
+ | <td>TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG<br>CATGACGCTATCGCAGCACGACTATCGCGCG</td> | ||
+ | <td style="text-align:center">84</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Oligo 4</td> | ||
+ | <td>GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC<br>GTCATGCGTGTGTCAGAGTGCACTGTCACAT</td> | ||
+ | <td style="text-align:center">84</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Oligo 5</td> | ||
+ | <td>ATGGCACCCAGTGGAGTTAGACCCTGATTG</td> | ||
+ | <td style="text-align:center">30</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <br> | ||
+ | <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt=""> | ||
+ | <br> | ||
+ | <p class="text-justify" align="left"><font size="3"> | ||
+ | To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease. | ||
+ | The miRNA is expected to displace O5 from the tetrahedral structure. | ||
+ | With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced. | ||
+ | Oligo 1 would then be able to fold into a G-quadruplex structure, | ||
+ | which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color. | ||
+ | The sequence of the miRNA for Huntington disease used for testing is shown below: | ||
+ | </font></p> | ||
+ | <table class="table"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th style="text-align:center">Input Oligo</th> | ||
+ | <th>Sequence</th> | ||
+ | <th style="text-align:center">Size (nucleotide)</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td style="text-align:center">Input</td> | ||
+ | <td>CAATCAGGGTCTAACTCCACTGGGTGCCAT</td> | ||
+ | <td style="text-align:center">30</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="text-align:center">RNA Input</td> | ||
+ | <td>CAAUCAGGGUCUAACUCCACUGGGUGCCAU</td> | ||
+ | <td style="text-align:center">30</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p class="text-justify"><font size="3"> | ||
+ | For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases. | ||
+ | </font></p> | ||
+ | </div> | ||
</div> | </div> | ||
− | + | </div> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<!-- footer --> | <!-- footer --> | ||
− | + | <footer class="text-center"></footer> | |
− | <footer class="text-center"> | + | <script src="https://2016.igem.org/Team:Hong_Kong_HKU/JS/jQuery?action=raw&ctype=text/javascript" type="text/javascript"></script> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script> | <script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script> | ||
− | |||
</body> | </body> | ||
− | |||
</html> | </html> | ||
+ | {{Hong_Kong_HKU/Footer}} |
Latest revision as of 19:51, 19 October 2016
Project
Design
Our design is a tetrahedral nanostructure for diagnostic purposes.
It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides.
The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC.
The details of the DNA nanostructure assembly can be found in here.
The oligo sequences are shown below:
Tetra forming Oligo | Sequence | Size (nucleotide) |
---|---|---|
Oligo 1 | CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA |
97 |
Oligo 2 | CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC GATAGCAGACGACG |
67 |
Oligo 3 | TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG CATGACGCTATCGCAGCACGACTATCGCGCG |
84 |
Oligo 4 | GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC GTCATGCGTGTGTCAGAGTGCACTGTCACAT |
84 |
Oligo 5 | ATGGCACCCAGTGGAGTTAGACCCTGATTG | 30 |
To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease. The miRNA is expected to displace O5 from the tetrahedral structure. With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced. Oligo 1 would then be able to fold into a G-quadruplex structure, which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color. The sequence of the miRNA for Huntington disease used for testing is shown below:
Input Oligo | Sequence | Size (nucleotide) |
---|---|---|
Input | CAATCAGGGTCTAACTCCACTGGGTGCCAT | 30 |
RNA Input | CAAUCAGGGUCUAACUCCACUGGGUGCCAU | 30 |
For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases.