Difference between revisions of "Team:Hong Kong HKU/Design"

(Prototype team page)
 
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
{{Hong_Kong_HKU}}
 
 
<html>
 
<html>
−
 
+
<meta http-equiv="X-UA-Compatible" content="IE=edge">
−
 
+
<meta name="viewport" content="width=device-width, initial-scale=1.0">
−
<div class="column full_size judges-will-not-evaluate">
+
<style>
−
<h3>★  ALERT! </h3>
+
#sideMenu
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2016.igem.org/Judging/Awards#Special_Prizes"> design special prize</a>. </p>
+
{display:none; /* Disable the display of the annoying side main menu*/}
−
 
+
#top_title
−
 
+
{display:none; /* Disable the annoying title*/}
−
<p> Delete this box in order to be evaluated for this medal. See more information at <a href="https://2016.igem.org/Judging/Pages_for_Awards/Instructions"> Instructions for Pages for awards</a>.</p>
+
#content
 +
{padding:0px; width:90%; margin-left:5%; margin-right:5%;background-color: rgba(255,255,255,0);}
 +
body
 +
{margin: 0;
 +
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
 +
font-size: 24px;
 +
color: #333333;
 +
background-color: #fafafa;
 +
background-image:url(https://static.igem.org/mediawiki/2016/a/ae/T--Hong_Kong_HKU--Background_image.png);
 +
background-position:center center;
 +
background-repeat:no-repeat;
 +
-moz-background-size: cover;
 +
background-size: cover;
 +
background-attachment:fixed;}
 +
.container
 +
{background-color: rgba(255,255,255,0.6);
 +
padding-top:80px;}
 +
p {font-size: 16px;}
 +
h1,h2,h3,h4,h5,h6 {color: #282828;}
 +
h1 {font-size:72px;} h2 {font-size:48px;} h3 {font-size:36px;}
 +
h4 {font-size:32px;} h5 {font-size:28px;} h6 {font-size:24px;}
 +
.nav-pills>li.active>a{background-color:#93d66b !important;}
 +
.nav-pills>li>a:hover{background-color:#b2dd75 !important; color:#FFFFFF!important;}
 +
.nav-pills>li.active>a:hover{background-color:#93d66b !important;}
 +
</style>
 +
<link href="css/bootstrap.css" rel="stylesheet" type="text/css">
 +
<!-- HTML5 shim and Respond.js for IE8 support of HTML5 elements and media queries -->
 +
<!-- WARNING: Respond.js doesn't work if you view the page via file:// -->
 +
<!--[if lt IE 9]>
 +
<script src="https://oss.maxcdn.com/html5shiv/3.7.2/html5shiv.min.js"></script>
 +
<script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script>
 +
<![endif]-->
 +
<head>
 +
<meta charset="utf-8">
 +
<meta http-equiv="X-UA-Compatible" content="IE=edge">
 +
<meta name="viewport" content="width=device-width, initial-scale=1">
 +
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 +
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 +
</head>
 +
</html>
 +
{{Hong_Kong_HKU/Header}}
 +
<html>
 +
<body>
 +
<div class="container" align="center">
 +
    <h2>Project</h2>
 +
    <ul class="nav nav-pills">
 +
      <li class="dropdown">
 +
          <a class="dropdown-toggle" data-toggle="dropdown" href="#">Description<span class="caret"></span></a>
 +
            <ul class="dropdown-menu">
 +
              <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Inspiration">Inspiration</a></li>
 +
              <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Objectives">Objectives</a></li>
 +
              <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Progress">Progress</a></li>
 +
              <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description#tab_Sigificances">Sigificances</a></li>
 +
            </ul>
 +
      </li>
 +
      <li class="active"><a data-toggle="pill" href="#">Design</a></li>
 +
    </ul>
 +
    <div class="tab-content">
 +
      <div id="Design" class="tab-pane fade in active">
 +
        <h3>Design</h3>
 +
        <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/a/af/T--Hong_Kong_HKU--StrandDisplacement.jpg" alt="">
 +
    <p class="text-justify" align="left"><font size="3">
 +
        Our design is a tetrahedral nanostructure for diagnostic purposes.  
 +
        It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides.
 +
        The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC.
 +
        The details of the DNA nanostructure assembly can be found in <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Experiments">here</a>.
 +
        The oligo sequences are shown below:<br>
 +
        </font></p>
 +
        <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/9/91/T--Hong_Kong_HKU--TetraDesign1.png" alt=""><br>
 +
        <table class="table">
 +
        <thead>
 +
            <tr>
 +
                <th style="text-align:center">Tetra forming Oligo</th>
 +
                    <th>Sequence</th>
 +
                    <th style="text-align:center">Size (nucleotide)</th>
 +
                </tr>
 +
            </thead>
 +
            <tbody>
 +
            <tr>
 +
                <td style="text-align:center">Oligo 1</td>
 +
                    <td>CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT<br>CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA</td>
 +
                    <td style="text-align:center">97</td>
 +
                </tr>
 +
            <tr>
 +
                <td style="text-align:center">Oligo 2</td>
 +
                    <td>CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC<br>GATAGCAGACGACG</td>
 +
                    <td style="text-align:center">67</td>
 +
                </tr>
 +
            <tr>
 +
                <td style="text-align:center">Oligo 3</td>
 +
                    <td>TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG<br>CATGACGCTATCGCAGCACGACTATCGCGCG</td>
 +
                    <td style="text-align:center">84</td>
 +
                </tr>
 +
            <tr>
 +
                <td style="text-align:center">Oligo 4</td>
 +
                    <td>GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC<br>GTCATGCGTGTGTCAGAGTGCACTGTCACAT</td>
 +
                    <td style="text-align:center">84</td>
 +
                </tr>
 +
            <tr>
 +
                <td style="text-align:center">Oligo 5</td>
 +
                    <td>ATGGCACCCAGTGGAGTTAGACCCTGATTG</td>
 +
                    <td style="text-align:center">30</td>
 +
                </tr>
 +
            </tbody>
 +
        </table>
 +
        <br>
 +
        <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt="">
 +
        <br>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease.
 +
        The miRNA is expected to displace O5 from the tetrahedral structure.
 +
        With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced.
 +
        Oligo 1 would then be able to fold into a G-quadruplex structure,
 +
        which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color.
 +
        The sequence of the miRNA for Huntington disease used for testing is shown below:
 +
        </font></p>
 +
        <table class="table">
 +
        <thead>
 +
            <tr>
 +
                <th style="text-align:center">Input Oligo</th>
 +
                    <th>Sequence</th>
 +
                    <th style="text-align:center">Size (nucleotide)</th>
 +
                </tr>
 +
            </thead>
 +
            <tbody>
 +
            <tr>
 +
                <td style="text-align:center">Input</td>
 +
                    <td>CAATCAGGGTCTAACTCCACTGGGTGCCAT</td>
 +
                    <td style="text-align:center">30</td>
 +
                </tr>
 +
            <tr>
 +
                <td style="text-align:center">RNA Input</td>
 +
                    <td>CAAUCAGGGUCUAACUCCACUGGGUGCCAU</td>
 +
                    <td style="text-align:center">30</td>
 +
                </tr>
 +
            </tbody>
 +
        </table>
 +
          <p class="text-justify"><font size="3">
 +
          For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases.
 +
        </font></p>
 +
      </div>
 +
    </div>
 
</div>
 
</div>
  
−
 
+
<!-- footer -->
−
 
+
<footer class="text-center"></footer>
−
<div class="column full_size">
+
<script src="https://2016.igem.org/Team:Hong_Kong_HKU/JS/jQuery?action=raw&ctype=text/javascript" type="text/javascript"></script>
−
 
+
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script>
−
 
+
</body>
−
<p>
+
−
By talking about your design work on this page, there is one medal criterion that you can attempt to meet, and one award that you can apply for. If your team is going for a gold medal by building a functional prototype, you should tell us what you did on this page.
+
−
</p>
+
−
 
+
−
 
+
−
<p>This is a prize for the team that has developed a synthetic biology product to solve a real world problem in the most elegant way. The students will have considered how well the product addresses the problem versus other potential solutions, how the product integrates or disrupts other products and processes, and how its lifecycle can more broadly impact our lives and environments in positive and negative ways.</p>
+
−
 
+
−
<p>
+
−
If you are working on art and design as your main project, please join the art and design track. If you are integrating art and design into the core of your main project, please apply for the award by completing this page.
+
−
</p>
+
−
 
+
−
 
+
−
<p>Teams who want to focus on art and design should be in the art and design special track. If you want to have a sub-project in this area, you should compete for this award.</p>
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
 
+
−
 
+
 
</html>
 
</html>
 +
{{Hong_Kong_HKU/Footer}}

Latest revision as of 19:51, 19 October 2016

Project

Design

Our design is a tetrahedral nanostructure for diagnostic purposes. It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides. The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC. The details of the DNA nanostructure assembly can be found in here. The oligo sequences are shown below:


Tetra forming Oligo Sequence Size (nucleotide)
Oligo 1 CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT
CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA		 97
Oligo 2 CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC
GATAGCAGACGACG		 67
Oligo 3 TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG
CATGACGCTATCGCAGCACGACTATCGCGCG		 84
Oligo 4 GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC
GTCATGCGTGTGTCAGAGTGCACTGTCACAT		 84
Oligo 5 ATGGCACCCAGTGGAGTTAGACCCTGATTG 30


To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease. The miRNA is expected to displace O5 from the tetrahedral structure. With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced. Oligo 1 would then be able to fold into a G-quadruplex structure, which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color. The sequence of the miRNA for Huntington disease used for testing is shown below:

Input Oligo Sequence Size (nucleotide)
Input CAATCAGGGTCTAACTCCACTGGGTGCCAT 30
RNA Input CAAUCAGGGUCUAACUCCACUGGGUGCCAU 30

For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases.


Copyright © 2016 HKU iGEM. All rights reserved.