Difference between revisions of "Team:Hong Kong HKU/Experiments"

(Update information)
m
 
(11 intermediate revisions by 2 users not shown)
Line 20: Line 20:
 
background-attachment:fixed;}
 
background-attachment:fixed;}
 
.container
 
.container
−
{background-color: rgba(255,255,255,0.4);
+
{background-color: rgba(255,255,255,0.6);
 
padding-top:80px;}
 
padding-top:80px;}
 
p {font-size: 16px;}
 
p {font-size: 16px;}
Line 40: Line 40:
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
−
 
 
</head>
 
</head>
 
</html>
 
</html>
Line 49: Line 48:
 
     <h2>Notebook</h2>
 
     <h2>Notebook</h2>
 
     <ul class="nav nav-pills">
 
     <ul class="nav nav-pills">
−
       <li class="active"><a href="">Working Log</a></li>
+
       <li ><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook">Working Log</a></li>
−
       <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Experiments">Experiments and Protocol</a></li>
+
       <li class="active dropdown">
 +
          <a class="dropdown-toggle" data-toggle="dropdown" href="#">Experiments and Protocol<span class="caret"></span></a>
 +
            <ul class="dropdown-menu">
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra">DNA Nanostructure Assembly</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE">Native Polyacrylamide gel electrophoresis (PAGE)</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS">ABTS</a></li>
 +
            </ul>
 +
      </li>
 
       <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li>
 
       <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li>
 
     </ul>
 
     </ul>
Line 56: Line 62:
 
       <div id="Protocol" class="tab-pane fade in active">
 
       <div id="Protocol" class="tab-pane fade in active">
 
         <h3>Protocol</h3>
 
         <h3>Protocol</h3>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:
 +
        </font></p>
 
         <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true">
 
         <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true">
 +
        <div class="panel panel-transparent">
 +
            <div class="panel-heading" role="tab">
 +
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>DNA Nanostructure Assembly</h3></a></h4>
 +
            </div>
 +
            <div id="Tetra" class="panel-collapse collapse in">
 +
              <div class="panel-body">
 +
                <p class="text-justify" align="left"><font size="3">
 +
                Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl<sub>2</sub>, pH 8), making the final concentration of each oligo to be 10μM.
 +
                The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.<br><br>
 +
                The following table shows the sequence of our tetrahedral DNA nanostructure.
 +
                Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5.
 +
                The colour code used is the same as that in the paper fold of the structure (below the table).
 +
              </font></p>
 +
              <div class="table-responsive">
 +
                  <table class="table">
 +
                    <thead>
 +
                        <tr>
 +
                            <th>Oligo</th>
 +
                            <th>Sequence (5' to 3')</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td>O1(97nt)</td>
 +
                            <td><font color="#ff00ff">CTACTAGCTGCACG</font><font color="#ff0000">A</font><font color="#a500ff">CGTAG</font><font color="a4004f">T</font><font color="#00ffff">GGGTT<u>GGG</u></font><font color="#a4004f"><u>T</u></font><u>CTAACTCCAC</u><font color="#a4004f"><br>
 +
                                <u>T</u></font><font color="#00ffff"><u>GGG</u>TAGGG</font><font color="#ff00ff">T</font><font color="#a500ff">CGTCG</font><font color="#ff0000">A</font><font color="#ff994f">GCTCACGTGCGTCACGCGCGATAG<br>
 +
                            TCG</font><font color="#ff0000">A</font><font color="#ff00ff">GTGCTGCTGAGTA</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O2(67nt)</td>
 +
                            <td><font color="#a500ff">CTACG</font><font color="#ff0000">A</font><font color="#38761d">GTGATGACGAGACATGTGACAGTGCAC</font><font color="#ff0000">A</font><font color="#00ff00">CTATGT<br>
 +
                            GCGCTCATCGCACGATAGCAG</font><font color="#ff0000">A</font><font color="#a500ff">CGACG</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O3(84nt)</td>
 +
                            <td><font color="#ff994f">TGACGCACGTGAGC</font><font color="#ff0000">A</font><font color="#00ff00">CTGCTATCGTGCGATGAGCGCACAT<br>
 +
                              AG</font><font color="#ff0000">A</font><font color="#0000ff">CTGACACACGCATGACGCTATCGCAGC</font><font color="#ff0000">A</font><font color="#ff994f">CGACTATCG<br>
 +
                            CGCG</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O4(84nt)</td>
 +
                            <td><font color="#38761d">GTCTCGTCATCAC</font><font color="#ff0000">A</font><font color="#ff00ff">CGTGCAGCTAGTAGTACTCAGCAGCA<br>
 +
                              C</font><font color="#ff0000">A</font><font color="#0000ff">GCTGCGATAGCGTCATGCGTGTGTCAG</font><font color="#ff0000">A</font><font color="#38761d">GTGCACTGTC<br>
 +
                            ACAT</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O5(30nt)</td>
 +
                            <td>
 +
                            ATGGCA<u>CCCAGTGGAGTTAGACCC</u>TGATTG
 +
                            </td>
 +
                        </tr>
 +
                    </tbody>
 +
                  </table>
 +
              </div>
 +
              <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt="">
 +
              </div>
 +
            </div>
 +
          </div>
 
           <div class="panel panel-transparent">
 
           <div class="panel panel-transparent">
−
             <div class="panel-heading" role="tab">
+
             <div class="panel-heading">
−
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis</h3></a></h4>
+
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis (PAGE)</h3></a></h4>
 
             </div>
 
             </div>
 
             <div id="PAGE" class="panel-collapse collapse in">
 
             <div id="PAGE" class="panel-collapse collapse in">
 
               <div class="panel-body">
 
               <div class="panel-body">
−
              <h4>General preparation of Native Polyacrylamide gel (Native PAGE gel)</h4>
+
                <p class="text-justify" align="left"><font size="3">
−
              <p align="left"><font size="3">
+
                The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded.
−
              <br>
+
                For analysis by 1% agarose gel, 10μL samples (10μM) are loaded.  
−
              <b>Specifications</b><br>
+
                All the agarose gels are run at a constant voltage of 100V.  
−
              A piece of PAGE Gel (~12mL in volume)<br>
+
                GelRed is used to prestained the gels.<br><br>
−
              <b>Requiring Materials</b><br>
+
                For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker.  
−
              <table class="table" border="0" >
+
                The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel.  
−
                  <thead>
+
                The PAGE is conducted at a constant voltage of 100V.  
−
                      <tr>
+
                GelRed is used to prestained the gel.
−
                          <th>Materials (12% PAGE gel)</th>
+
                </font></p>  
−
                          <th>Quantity</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                      <tr>
+
−
                          <td>Gel kit</td>
+
−
                          <td>1 Set</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>Distilled water</td>
+
−
                          <td>6.0 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>10X TBE</td>
+
−
                          <td>1.2 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>30% Acrylamide (29:1)</td>
+
−
                          <td>4.8 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>10% APS</td>
+
−
                          <td>200 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>TEMED</td>
+
−
                          <td>200 μL</td>
+
−
                      </tr>
+
−
                  </tbody>
+
−
              </table>
+
−
              <b>Storage</b><br>
+
−
              4°C, keep wet in 1x TBE to prevent drying<br>
+
−
              <b>Steps</b><br>
+
−
              1. Clean the glass plates and spacers thoroughly. Rinse the plates withdeionized water and ethanol and set them aside to dry.<br>
+
−
              2. Assemble the glass plates with spacers in gel caster. Make sure there is no water leakage.<br>
+
−
              3. Prepare the gel solution according to the desired polyacrylamide percentage. Note the addition of TEMED will immediately trigger the gel to polymerize.<br>
+
−
              4. Vortex the solution roughly for 5 seconds.<br>
+
−
              5. Quickly piette the gel solution into the caster. Insert the appropriate comb into the gel, prevent to trap air bubbles under the teeth.<br>
+
−
              6. Let the polymerization go for 30 minutes at room temperature.<br>
+
−
              7. Surround the comb and the top of the gel with paper towels that have been soaked in 1x TBE.
+
−
              Then seal the entire gel in  plastic bag and store it at 4°C until needed.<br>
+
−
              <b>Notes</b><br>
+
−
              Different polyacrylamide percentage results in different speed and discrimating ability for sample running down in electrophoresis.
+
−
              The quantity of the solutions varies with the percentage.
+
−
              The required quantity of native PAGE gel in common polyacrylamide percentage is listed below. <br>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th> Polyacrylamide percentage </th>
+
−
                          <th> Distilled water </th>
+
−
                          <th> 30% Acrylamide (29:1) </th>
+
−
                          <th> 10X TBE </th>
+
−
                          <th> 10% APS </th>
+
−
                          <th> TEMED  </th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >8%</td>
+
−
                          <td style="text-align:center" >7.6 mL</td>
+
−
                          <td style="text-align:center" >3.2 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >10%</td>
+
−
                          <td style="text-align:center" >6.8 mL</td>
+
−
                          <td style="text-align:center" >4.0mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >12%</td>
+
−
                          <td style="text-align:center" >6.0 mL</td>
+
−
                          <td style="text-align:center" >4.8 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >15%</td>
+
−
                          <td style="text-align:center" >5.2 mL</td>
+
−
                          <td style="text-align:center" >5.6 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                  </tbody>
+
−
              </table>
+
−
              </font></p>
+
 
               </div>
 
               </div>
 
             </div>
 
             </div>
Line 172: Line 147:
 
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4>
 
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4>
 
             </div>
 
             </div>
−
             <div id="ABTS" class="panel-collapse collapse">
+
             <div id="ABTS" class="panel-collapse collapse in">
 
               <div class="panel-body">
 
               <div class="panel-body">
 
                 <p class="text-justify" align="left"><font size="3">
 
                 <p class="text-justify" align="left"><font size="3">
−
                  
+
                 ABTS assay is used to detect G-quadruplex.
 +
                DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH<sub>4</sub>Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5).
 +
                The mixture is incubated at room temperature for 30 minutes in a shaker.
 +
                100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL.
 +
                The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.<br><br>
 
                 </font></p>
 
                 </font></p>
 
               </div>
 
               </div>
Line 181: Line 160:
 
           </div>
 
           </div>
 
         </div>
 
         </div>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        Looking for more details? Click <a href="https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKU--DetailedProtocol.pdf">here</a> to explore!<br><br>
 +
        </font></p>
 
       </div>
 
       </div>
 
     </div>
 
     </div>
−
</div>
+
  </div>
  
 
<!-- footer -->
 
<!-- footer -->

Latest revision as of 02:29, 20 October 2016

Notebook

Protocol

One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:

Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.

The following table shows the sequence of our tetrahedral DNA nanostructure. Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5. The colour code used is the same as that in the paper fold of the structure (below the table).

Oligo Sequence (5' to 3')
O1(97nt) CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCAC
TGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAG
TCGAGTGCTGCTGAGTA
O2(67nt) CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGT
GCGCTCATCGCACGATAGCAGACGACG
O3(84nt) TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACAT
AGACTGACACACGCATGACGCTATCGCAGCACGACTATCG
CGCG
O4(84nt) GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCA
CAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTC
ACAT
O5(30nt) ATGGCACCCAGTGGAGTTAGACCCTGATTG

Native Polyacrylamide gel electrophoresis (PAGE)

The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded. For analysis by 1% agarose gel, 10μL samples (10μM) are loaded. All the agarose gels are run at a constant voltage of 100V. GelRed is used to prestained the gels.

For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel. The PAGE is conducted at a constant voltage of 100V. GelRed is used to prestained the gel.

ABTS Assay

ABTS assay is used to detect G-quadruplex. DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H2O2 (12mM final) are added to the mixture, making the final volume to be 150μL. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.

Looking for more details? Click here to explore!


Copyright © 2016 HKU iGEM. All rights reserved.