Louislo3412 (Talk | contribs) (Update information) |
Louislo3412 (Talk | contribs) m |
||
(10 intermediate revisions by 2 users not shown) | |||
Line 20: | Line 20: | ||
background-attachment:fixed;} | background-attachment:fixed;} | ||
.container | .container | ||
− | {background-color: rgba(255,255,255,0. | + | {background-color: rgba(255,255,255,0.6); |
padding-top:80px;} | padding-top:80px;} | ||
p {font-size: 16px;} | p {font-size: 16px;} | ||
Line 40: | Line 40: | ||
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | <link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | ||
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | <link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet"> | ||
− | |||
</head> | </head> | ||
</html> | </html> | ||
Line 49: | Line 48: | ||
<h2>Notebook</h2> | <h2>Notebook</h2> | ||
<ul class="nav nav-pills"> | <ul class="nav nav-pills"> | ||
− | <li | + | <li ><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook">Working Log</a></li> |
− | <li><a href=" | + | <li class="active dropdown"> |
+ | <a class="dropdown-toggle" data-toggle="dropdown" href="#">Experiments and Protocol<span class="caret"></span></a> | ||
+ | <ul class="dropdown-menu"> | ||
+ | <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra">DNA Nanostructure Assembly</a></li> | ||
+ | <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE">Native Polyacrylamide gel electrophoresis (PAGE)</a></li> | ||
+ | <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS">ABTS</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
<li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li> | <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li> | ||
</ul> | </ul> | ||
Line 56: | Line 62: | ||
<div id="Protocol" class="tab-pane fade in active"> | <div id="Protocol" class="tab-pane fade in active"> | ||
<h3>Protocol</h3> | <h3>Protocol</h3> | ||
+ | <p class="text-justify" align="left"><font size="3"> | ||
+ | One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here: | ||
+ | </font></p> | ||
<div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true"> | <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true"> | ||
<div class="panel panel-transparent"> | <div class="panel panel-transparent"> | ||
<div class="panel-heading" role="tab"> | <div class="panel-heading" role="tab"> | ||
− | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>Assembly | + | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>DNA Nanostructure Assembly</h3></a></h4> |
</div> | </div> | ||
<div id="Tetra" class="panel-collapse collapse in"> | <div id="Tetra" class="panel-collapse collapse in"> | ||
<div class="panel-body"> | <div class="panel-body"> | ||
− | + | <p class="text-justify" align="left"><font size="3"> | |
− | + | Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl<sub>2</sub>, pH 8), making the final concentration of each oligo to be 10μM. | |
− | + | The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.<br><br> | |
− | + | The following table shows the sequence of our tetrahedral DNA nanostructure. | |
− | + | Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5. | |
− | + | The colour code used is the same as that in the paper fold of the structure (below the table). | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</font></p> | </font></p> | ||
+ | <div class="table-responsive"> | ||
+ | <table class="table"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th>Oligo</th> | ||
+ | <th>Sequence (5' to 3')</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td>O1(97nt)</td> | ||
+ | <td><font color="#ff00ff">CTACTAGCTGCACG</font><font color="#ff0000">A</font><font color="#a500ff">CGTAG</font><font color="a4004f">T</font><font color="#00ffff">GGGTT<u>GGG</u></font><font color="#a4004f"><u>T</u></font><u>CTAACTCCAC</u><font color="#a4004f"><br> | ||
+ | <u>T</u></font><font color="#00ffff"><u>GGG</u>TAGGG</font><font color="#ff00ff">T</font><font color="#a500ff">CGTCG</font><font color="#ff0000">A</font><font color="#ff994f">GCTCACGTGCGTCACGCGCGATAG<br> | ||
+ | TCG</font><font color="#ff0000">A</font><font color="#ff00ff">GTGCTGCTGAGTA</font></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>O2(67nt)</td> | ||
+ | <td><font color="#a500ff">CTACG</font><font color="#ff0000">A</font><font color="#38761d">GTGATGACGAGACATGTGACAGTGCAC</font><font color="#ff0000">A</font><font color="#00ff00">CTATGT<br> | ||
+ | GCGCTCATCGCACGATAGCAG</font><font color="#ff0000">A</font><font color="#a500ff">CGACG</font></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>O3(84nt)</td> | ||
+ | <td><font color="#ff994f">TGACGCACGTGAGC</font><font color="#ff0000">A</font><font color="#00ff00">CTGCTATCGTGCGATGAGCGCACAT<br> | ||
+ | AG</font><font color="#ff0000">A</font><font color="#0000ff">CTGACACACGCATGACGCTATCGCAGC</font><font color="#ff0000">A</font><font color="#ff994f">CGACTATCG<br> | ||
+ | CGCG</font></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>O4(84nt)</td> | ||
+ | <td><font color="#38761d">GTCTCGTCATCAC</font><font color="#ff0000">A</font><font color="#ff00ff">CGTGCAGCTAGTAGTACTCAGCAGCA<br> | ||
+ | C</font><font color="#ff0000">A</font><font color="#0000ff">GCTGCGATAGCGTCATGCGTGTGTCAG</font><font color="#ff0000">A</font><font color="#38761d">GTGCACTGTC<br> | ||
+ | ACAT</font></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>O5(30nt)</td> | ||
+ | <td> | ||
+ | ATGGCA<u>CCCAGTGGAGTTAGACCC</u>TGATTG | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div> | ||
+ | <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt=""> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 407: | Line 126: | ||
<div class="panel panel-transparent"> | <div class="panel panel-transparent"> | ||
<div class="panel-heading"> | <div class="panel-heading"> | ||
− | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="# | + | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis (PAGE)</h3></a></h4> |
</div> | </div> | ||
− | <div id=" | + | <div id="PAGE" class="panel-collapse collapse in"> |
<div class="panel-body"> | <div class="panel-body"> | ||
− | |||
<p class="text-justify" align="left"><font size="3"> | <p class="text-justify" align="left"><font size="3"> | ||
− | + | The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded. | |
− | + | For analysis by 1% agarose gel, 10μL samples (10μM) are loaded. | |
− | + | All the agarose gels are run at a constant voltage of 100V. | |
− | + | GelRed is used to prestained the gels.<br><br> | |
− | + | For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. | |
− | + | The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel. | |
− | + | The PAGE is conducted at a constant voltage of 100V. | |
− | + | GelRed is used to prestained the gel. | |
− | + | </font></p> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | </font></p> | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
</div> | </div> | ||
Line 515: | Line 147: | ||
<h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4> | <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4> | ||
</div> | </div> | ||
− | <div id="ABTS" class="panel-collapse collapse"> | + | <div id="ABTS" class="panel-collapse collapse in"> |
<div class="panel-body"> | <div class="panel-body"> | ||
<p class="text-justify" align="left"><font size="3"> | <p class="text-justify" align="left"><font size="3"> | ||
+ | ABTS assay is used to detect G-quadruplex. | ||
+ | DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH<sub>4</sub>Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). | ||
+ | The mixture is incubated at room temperature for 30 minutes in a shaker. | ||
+ | 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL. | ||
+ | The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.<br><br> | ||
</font></p> | </font></p> | ||
</div> | </div> | ||
Line 523: | Line 160: | ||
</div> | </div> | ||
</div> | </div> | ||
+ | <p class="text-justify" align="left"><font size="3"> | ||
+ | Looking for more details? Click <a href="https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKU--DetailedProtocol.pdf">here</a> to explore!<br><br> | ||
+ | </font></p> | ||
</div> | </div> | ||
</div> | </div> |
Latest revision as of 02:29, 20 October 2016
Notebook
Protocol
One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:
Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM.
The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.
The following table shows the sequence of our tetrahedral DNA nanostructure.
Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5.
The colour code used is the same as that in the paper fold of the structure (below the table).
Oligo | Sequence (5' to 3') |
---|---|
O1(97nt) | CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCAC TGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAG TCGAGTGCTGCTGAGTA |
O2(67nt) | CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGT GCGCTCATCGCACGATAGCAGACGACG |
O3(84nt) | TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACAT AGACTGACACACGCATGACGCTATCGCAGCACGACTATCG CGCG |
O4(84nt) | GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCA CAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTC ACAT |
O5(30nt) | ATGGCACCCAGTGGAGTTAGACCCTGATTG |
The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded.
For analysis by 1% agarose gel, 10μL samples (10μM) are loaded.
All the agarose gels are run at a constant voltage of 100V.
GelRed is used to prestained the gels.
For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker.
The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel.
The PAGE is conducted at a constant voltage of 100V.
GelRed is used to prestained the gel.
ABTS assay is used to detect G-quadruplex.
DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5).
The mixture is incubated at room temperature for 30 minutes in a shaker.
100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H2O2 (12mM final) are added to the mixture, making the final volume to be 150μL.
The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.
Looking for more details? Click here to explore!