Difference between revisions of "Team:Hong Kong HKU/Experiments"

m
 
(8 intermediate revisions by 2 users not shown)
Line 20: Line 20:
 
background-attachment:fixed;}
 
background-attachment:fixed;}
 
.container
 
.container
−
{background-color: rgba(255,255,255,0.4);
+
{background-color: rgba(255,255,255,0.6);
 
padding-top:80px;}
 
padding-top:80px;}
 
p {font-size: 16px;}
 
p {font-size: 16px;}
Line 49: Line 49:
 
     <ul class="nav nav-pills">
 
     <ul class="nav nav-pills">
 
       <li ><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook">Working Log</a></li>
 
       <li ><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook">Working Log</a></li>
−
       <li class="active"><a href="#">Experiments and Protocol</a></li>
+
       <li class="active dropdown">
 +
          <a class="dropdown-toggle" data-toggle="dropdown" href="#">Experiments and Protocol<span class="caret"></span></a>
 +
            <ul class="dropdown-menu">
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra">DNA Nanostructure Assembly</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE">Native Polyacrylamide gel electrophoresis (PAGE)</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS">ABTS</a></li>
 +
            </ul>
 +
      </li>
 
       <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li>
 
       <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li>
 
     </ul>
 
     </ul>
Line 55: Line 62:
 
       <div id="Protocol" class="tab-pane fade in active">
 
       <div id="Protocol" class="tab-pane fade in active">
 
         <h3>Protocol</h3>
 
         <h3>Protocol</h3>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:
 +
        </font></p>
 
         <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true">
 
         <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true">
 
         <div class="panel panel-transparent">
 
         <div class="panel panel-transparent">
 
             <div class="panel-heading" role="tab">
 
             <div class="panel-heading" role="tab">
−
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>Assembly of DNA nanostructure</h3></a></h4>
+
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>DNA Nanostructure Assembly</h3></a></h4>
 
             </div>
 
             </div>
 
             <div id="Tetra" class="panel-collapse collapse in">
 
             <div id="Tetra" class="panel-collapse collapse in">
 
               <div class="panel-body">
 
               <div class="panel-body">
−
                  Equal amounts of the oligonucleotides are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler. The following table shows the sequence of our tetrahedral DNA nanostructure.<br>
+
                <p class="text-justify" align="left"><font size="3">
−
                    </font></p>
+
                Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl<sub>2</sub>, pH 8), making the final concentration of each oligo to be 10μM.  
−
                    <table class="table" border="0" >
+
                The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.<br><br>
−
                        <thead>
+
                The following table shows the sequence of our tetrahedral DNA nanostructure.  
−
                            <tr>
+
                 Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5.  
−
                                <th>Oligo Name</th>
+
                The colour code used is the same as that in the paper fold of the structure (below the table).
−
                                <th>Sequence (5' to 3')</th>
+
−
                            </tr>
+
−
                        </thead>
+
−
                        <tbody>
+
−
                            <tr>
+
−
                                <td>O1 (97nt)</td>
+
−
                                <td>CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAGTCGA<br>
+
−
                                        GTGCTGCTGAGTA</td>
+
−
                            </tr>
+
−
                            <tr>
+
−
                                <td>O2 (67nt)</td>
+
−
                                <td>CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCACGATAGCAGACGACG</td>
+
−
                            </tr>
+
−
                            <tr>
+
−
                                <td>O3 (84nt)</td>
+
−
                                <td>TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACGCATGACGCTATCGCAGCACGACTATCGCGCG</td>
+
−
                            </tr>
+
−
                            <tr>
+
−
                                <td>O4 (84nt)</td>
+
−
                                <td>GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTCACAT</td>
+
−
                            </tr>
+
−
                            <tr>
+
−
                                <td>O5 (30nt)</td>
+
−
                                <td>ATGGCACCCAGTGGAGTTAGACCCTGATTG</td>
+
−
                            </tr>
+
−
                        </tbody>
+
−
                    </table>
+
−
                    </div>
+
−
                 </div>
+
−
            </div>
+
−
          <div class="panel panel-transparent">
+
−
            <div class="panel-heading" role="tab">
+
−
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis</h3></a></h4>
+
−
            </div>
+
−
            <div id="PAGE" class="panel-collapse collapse in">
+
−
              <div class="panel-body">
+
−
              <h4>General preparation of Native Polyacrylamide gel (Native PAGE gel)</h4>
+
−
              <p align="left"><font size="3">
+
−
              <br>
+
−
              <b>Specifications</b><br>
+
−
              A piece of PAGE Gel (~12mL in volume)<br>
+
−
              <b>Requiring Materials</b><br>
+
−
              </font></p>
+
−
              <table class="table" border="0" >
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th>Materials (12% PAGE gel)</th>
+
−
                          <th>Quantity</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                      <tr>
+
−
                          <td>Gel kit</td>
+
−
                          <td>1 Set</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>Distilled water</td>
+
−
                          <td>6.0 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>10X TBE</td>
+
−
                          <td>1.2 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>30% Acrylamide (29:1)</td>
+
−
                          <td>4.8 mL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>10% APS</td>
+
−
                          <td>200 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td>TEMED</td>
+
−
                          <td>200 μL</td>
+
−
                      </tr>
+
−
                  </tbody>
+
−
              </table>
+
−
              <p align="left"><font size="3">
+
−
              <b>Storage</b><br>
+
−
              4°C, keep wet in 1x TBE to prevent drying<br>
+
−
              <b>Steps</b><br>
+
−
              1. Clean the glass plates and spacers thoroughly. Rinse the plates withdeionized water and ethanol and set them aside to dry.<br>
+
−
              2. Assemble the glass plates with spacers in gel caster. Make sure there is no water leakage.<br>
+
−
              3. Prepare the gel solution according to the desired polyacrylamide percentage. Note the addition of TEMED will immediately trigger the gel to polymerize.<br>
+
−
              4. Vortex the solution roughly for 5 seconds.<br>
+
−
              5. Quickly piette the gel solution into the caster. Insert the appropriate comb into the gel, prevent to trap air bubbles under the teeth.<br>
+
−
              6. Let the polymerization go for 30 minutes at room temperature.<br>
+
−
              7. Surround the comb and the top of the gel with paper towels that have been soaked in 1x TBE.
+
−
              Then seal the entire gel in  plastic bag and store it at 4°C until needed.<br>
+
−
              <b>Notes</b><br>
+
−
              Different polyacrylamide percentage results in different speed and discrimating ability for sample running down in electrophoresis.
+
−
              The quantity of the solutions varies with the percentage.
+
−
              The required quantity of native PAGE gel in common polyacrylamide percentage is listed below. <br>
+
−
              </font></p>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th> Polyacrylamide percentage </th>
+
−
                          <th> Distilled water </th>
+
−
                          <th> 30% Acrylamide (29:1) </th>
+
−
                          <th> 10X TBE </th>
+
−
                          <th> 10% APS </th>
+
−
                          <th> TEMED  </th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >8%</td>
+
−
                          <td style="text-align:center" >7.6 mL</td>
+
−
                          <td style="text-align:center" >3.2 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >10%</td>
+
−
                          <td style="text-align:center" >6.8 mL</td>
+
−
                          <td style="text-align:center" >4.0mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >12%</td>
+
−
                          <td style="text-align:center" >6.0 mL</td>
+
−
                          <td style="text-align:center" >4.8 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                      <tr>
+
−
                          <td style="text-align:center" >15%</td>
+
−
                          <td style="text-align:center" >5.2 mL</td>
+
−
                          <td style="text-align:center" >5.6 mL</td>
+
−
                          <td style="text-align:center" >1.2 mL</td>
+
−
                          <td style="text-align:center" >200 μL</td>
+
−
                          <td style="text-align:center" >10 μL</td>
+
−
                      </tr>
+
−
                  </tbody>
+
−
              </table>
+
−
              <p align="left"><font size="3">
+
−
              <br>
+
−
              TBE buffer consists of Tris base, Boric Acid and EDTA. 
+
−
              Usually, a 10X concentration is prepared for making PAGE gels.
+
−
              For running the electrophoresis, the buffer is further diluted for 10 times to 1X concentration. <br>
+
−
              For 1L 10X TBE buffer can be prepared as follows:<br>
+
−
              </font></p>
+
−
              <table class="table">
+
−
              <thead>
+
−
                <tr>
+
−
                        <th>Materials</th>
+
−
                        <th>Quantity</th>
+
−
                    </tr>
+
−
                </thead>
+
−
                <tbody>
+
−
                <tr>
+
−
                    <td>Distilled water</td>
+
−
                        <td>~800 mL</td>
+
−
                    </tr>
+
−
                <tr>
+
−
                        <td>Tris</td>
+
−
                        <td>108 g</td>
+
−
                    </tr>
+
−
                    <tr>
+
−
                    <td>Boric acid</td>
+
−
                        <td>55 g</td>
+
−
                    </tr>
+
−
                    <tr>
+
−
                    <td>EDTA</td>
+
−
                        <td>7.5g</td>
+
−
                    </tr>
+
−
                </tbody>
+
−
              </table>
+
−
              <p align="left"><font size="3">
+
−
              <br>
+
−
              Remember to stir with a magnetic stirrer until the solution gets clear.
+
−
              Add up the solution to 1L with distilled water before autoclaving.<br><br>
+
−
              </font></p>
+
−
             
+
−
              <h4>Native PAGE</h4>
+
−
              <p align="left"><font size="3">
+
−
              <b>Steps</b><br>
+
−
              Load the followings. (DNA ladder: 2μL, DNA sample: 8μL, 1X loading dye: 8μL)
+
−
              </font></p>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th style="text-align:center">Lane</th>
+
−
                          <th style="text-align:center">1</th>
+
−
                          <th style="text-align:center">2</th>
+
−
                          <th style="text-align:center">3</th>
+
−
                          <th style="text-align:center">4</th>
+
−
                          <th style="text-align:center">5</th>
+
−
                          <th style="text-align:center">6</th>
+
−
                          <th style="text-align:center">7</th>
+
−
                          <th style="text-align:center">8</th>
+
−
                          <th style="text-align:center">9</th>
+
−
                          <th style="text-align:center">10</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                  <tr>
+
−
                    <td style="text-align:center">Gel A</td>
+
−
                        <td style="text-align:center">20 bp DNA ladder</td>
+
−
                        <td style="text-align:center">O1.6</td>
+
−
                        <td style="text-align:center">O2</td>
+
−
                        <td style="text-align:center">O3</td>
+
−
                        <td style="text-align:center">O4</td>
+
−
                        <td style="text-align:center">O5</td>
+
−
                        <td style="text-align:center">Input</td>
+
−
                        <td style="text-align:center">A1</td>
+
−
                        <td style="text-align:center">A2</td>
+
−
                        <td style="text-align:center">A3</td>
+
−
                    </tr>
+
−
                  <tr>
+
−
                    <td style="text-align:center">Gel B</td>
+
−
                        <td style="text-align:center">20 bp DNA ladder</td>
+
−
                        <td style="text-align:center">A4</td>
+
−
                        <td style="text-align:center">A5</td>
+
−
                        <td style="text-align:center">A6</td>
+
−
                        <td style="text-align:center">A7</td>
+
−
                        <td style="text-align:center">A8</td>
+
−
                        <td style="text-align:center">A9</td>
+
−
                        <td style="text-align:center">A10</td>
+
−
                        <td style="text-align:center">B1</td>
+
−
                        <td style="text-align:center">B2</td>
+
−
                    </tr>
+
−
                  <tr>
+
−
                    <td style="text-align:center">Gel C</td>
+
−
                        <td style="text-align:center">20 bp DNA ladder</td>
+
−
                        <td style="text-align:center">B3</td>
+
−
                        <td style="text-align:center">B4</td>
+
−
                        <td style="text-align:center">B5</td>
+
−
                        <td style="text-align:center">B6</td>
+
−
                        <td style="text-align:center">B7</td>
+
−
                        <td style="text-align:center">B8</td>
+
−
                        <td style="text-align:center">B9</td>
+
−
                        <td style="text-align:center">B10</td>
+
−
                        <td style="text-align:center">1X Loading buffer</td>
+
−
                    </tr>
+
−
                  <tr>
+
−
                    <td style="text-align:center">Gel D</td>
+
−
                        <td style="text-align:center">20 bp DNA ladder</td>
+
−
                        <td style="text-align:center">C1</td>
+
−
                        <td style="text-align:center">C2</td>
+
−
                        <td style="text-align:center">C3</td>
+
−
                        <td style="text-align:center">C4</td>
+
−
                        <td style="text-align:center">C5</td>
+
−
                        <td style="text-align:center">Tetra</td>
+
−
                        <td style="text-align:center">Tetra+Input</td>
+
−
                        <td style="text-align:center">Output</td>
+
−
                        <td style="text-align:center">1X Loading buffer</td>
+
−
                    </tr>
+
−
                  </tbody>
+
−
                </table>
+
−
              <p align="left"><font size="3">
+
−
              Run the gel at constant voltage at 100V for until the bands of dye reach ¾ of the length of the gel.
+
 
               </font></p>
 
               </font></p>
−
              </div>
+
              <div class="table-responsive">
−
            </div>
+
                  <table class="table">
−
          </div>
+
                     <thead>
−
          <div class="panel panel-transparent">
+
                         <tr>
−
            <div class="panel-heading">
+
                            <th>Oligo</th>
−
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Agarose"><h3>Agarose gel electrophoresis</h3></a></h4>
+
                            <th>Sequence (5' to 3')</th>
−
            </div>
+
−
            <div id="Agarose" class="panel-collapse collapse">
+
−
              <div class="panel-body">
+
−
              <h4>Preparation of agarose gel</h4>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br>
+
−
                <b>Specifications</b><br>
+
−
                A piece of 1% Agarose gel<br>
+
−
                <b>Requiring Materials</b><br>
+
−
                </font></p>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th>Material</th>
+
−
                          <th>Quantity</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                    <tr>
+
−
                          <td>Agarose powder</td>
+
−
                          <td>1 g</td>
+
−
                    </tr>
+
−
                  <tr>
+
−
                    <td>1X TBE</td>
+
−
<td>100mL</td>
+
−
                     </tr>
+
−
                  </tbody>
+
−
                </table>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br>
+
−
                <b>Storage</b><br>
+
−
4°C<br>
+
−
                <b>Steps</b><br>
+
−
                1. Pour 1g agarose powder into microwavable flask along with 100mL of 1xTBE.<br>
+
−
                2. Put into microwave for 1-3 minute until the agarose is completely dissolved. A nice rolling boil will be observed upon competion.<br>
+
−
                3. Let agarose solution cool down in room temperature for 5 minutes.<br>
+
−
                4. Pour the agarose into a gel tray with the well comb in place.<br>
+
−
                5. Place newly poured gel at 4°C for 10-15 minutes OR let sit at room temperature for 20-30 minutes, until it has completely solidified.<br>
+
−
                </font></p>
+
−
                <h4>Agarose gel electrophoresis</h4>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br>
+
−
                <b>Requiring Materials</b><br>
+
−
                </font></p>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th>Material</th>
+
−
                          <th>Quantity</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                  <tr>
+
−
                    <td></td>
+
−
                         <td></td>
+
−
                    </tr>
+
−
                  </tbody>
+
−
                </table>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br>
+
−
                <b>Steps</b><br>
+
−
                1. Cast the gel into position.<br>
+
−
                2. Fill the gel box with 1X TBE until the gel is covered by the buffer.<br>
+
−
                3. Load the DNA loading dye to samples.<br>
+
−
                4. Load the followings.<br>
+
−
                </font></p>
+
−
              <table class="table" border="0">
+
−
                  <thead>
+
−
                      <tr>
+
−
                          <th style="text-align:center">Lane 1</th>
+
−
                          <th style="text-align:center">Lane 2</th>
+
−
                          <th style="text-align:center">Lane 3</th>
+
−
                          <th style="text-align:center">Lane 4</th>
+
−
                          <th style="text-align:center">Lane 5</th>
+
−
                          <th style="text-align:center">Lane 6</th>
+
−
                          <th style="text-align:center">Lane 7</th>
+
−
                          <th style="text-align:center">Lane 8</th>
+
−
                          <th style="text-align:center">Lane 9</th>
+
−
                          <th style="text-align:center">Lane 10</th>
+
−
                          <th style="text-align:center">Lane 11</th>
+
−
                      </tr>
+
−
                  </thead>
+
−
                  <tbody>
+
−
                  <tr>
+
−
                      <td style="text-align:center">100bp DNA ladder</td>
+
−
                      <td style="text-align:center">DNA ladder (2 log)</td>
+
−
                      <td style="text-align:center">O1 (1μM)</td>
+
−
                      <td style="text-align:center">O2 (1μM)</td>
+
−
                      <td style="text-align:center">O3 (1μM)</td>
+
−
                      <td style="text-align:center">O4 (1μM)</td>
+
−
                      <td style="text-align:center">O5 (1μM)</td>
+
−
                      <td style="text-align:center">Input (1μM)</td>
+
−
                      <td style="text-align:center">O5+Input (1μM)</td>
+
−
                      <td style="text-align:center">Tetra (1μM)</td>
+
−
                      <td style="text-align:center">Tetra+Input</td>
+
−
                    </tr>
+
−
                  </tbody>
+
−
                </table>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br>
+
−
                5. Run the gel at a constant voltage of 100V for 1 hour.<br>
+
−
                </font></p>
+
−
              </div>
+
−
            </div>
+
−
          </div>
+
−
          <div class="panel panel-transparent">
+
−
            <div class="panel-heading">
+
−
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4>
+
−
            </div>
+
−
            <div id="ABTS" class="panel-collapse collapse">
+
−
              <div class="panel-body">
+
−
              <h4>Preparation of buffer for the reacting environment</h4>
+
−
                <p class="text-justify" align="left"><font size="3">
+
−
                <br><b>Specification</b><br>
+
−
                100mL of optimized reaction buffer containing 50mM of Tris–HCl, 150 mM NH<sub>4</sub>Cl, 20mM KCl, 0.03% Triton X-100, maintained at pH 7.5<br>
+
−
                <b>Requiring materials</b><br>
+
−
                </font></p>
+
−
                <table class="table">
+
−
                <thead>
+
−
                    <tr>
+
−
                        <th>Matrials</th>
+
−
                            <th>Quantity</th>
+
−
                        </tr>
+
−
                    </thead>
+
−
                    <tbody>
+
−
                    <tr>
+
−
                        <td>Distilled water</td>
+
−
                            <td>95 mL</td>
+
 
                         </tr>
 
                         </tr>
 +
                    </thead>
 +
                    <tbody>
 
                         <tr>
 
                         <tr>
−
                        <td>1M Tris</td>
+
                            <td>O1(97nt)</td>
−
                             <td>5 mL</td>
+
                             <td><font color="#ff00ff">CTACTAGCTGCACG</font><font color="#ff0000">A</font><font color="#a500ff">CGTAG</font><font color="a4004f">T</font><font color="#00ffff">GGGTT<u>GGG</u></font><font color="#a4004f"><u>T</u></font><u>CTAACTCCAC</u><font color="#a4004f"><br>
 +
                                <u>T</u></font><font color="#00ffff"><u>GGG</u>TAGGG</font><font color="#ff00ff">T</font><font color="#a500ff">CGTCG</font><font color="#ff0000">A</font><font color="#ff994f">GCTCACGTGCGTCACGCGCGATAG<br>
 +
                            TCG</font><font color="#ff0000">A</font><font color="#ff00ff">GTGCTGCTGAGTA</font></td>
 
                         </tr>
 
                         </tr>
 
                         <tr>
 
                         <tr>
−
                        <td>NH<sub>4</sub>Cl</td>
+
                            <td>O2(67nt)</td>
−
                             <td>0.8023 g</td>
+
                            <td><font color="#a500ff">CTACG</font><font color="#ff0000">A</font><font color="#38761d">GTGATGACGAGACATGTGACAGTGCAC</font><font color="#ff0000">A</font><font color="#00ff00">CTATGT<br>
 +
                             GCGCTCATCGCACGATAGCAG</font><font color="#ff0000">A</font><font color="#a500ff">CGACG</font></td>
 
                         </tr>
 
                         </tr>
 
                         <tr>
 
                         <tr>
−
                        <td>KCl</td>
+
                            <td>O3(84nt)</td>
−
                             <td>0.1491 g</td>
+
                             <td><font color="#ff994f">TGACGCACGTGAGC</font><font color="#ff0000">A</font><font color="#00ff00">CTGCTATCGTGCGATGAGCGCACAT<br>
 +
                              AG</font><font color="#ff0000">A</font><font color="#0000ff">CTGACACACGCATGACGCTATCGCAGC</font><font color="#ff0000">A</font><font color="#ff994f">CGACTATCG<br>
 +
                            CGCG</font></td>
 
                         </tr>
 
                         </tr>
 
                         <tr>
 
                         <tr>
−
                        <td>HCl</td>
+
                            <td>O4(84nt)</td>
−
                             <td>variable amount</td>
+
                             <td><font color="#38761d">GTCTCGTCATCAC</font><font color="#ff0000">A</font><font color="#ff00ff">CGTGCAGCTAGTAGTACTCAGCAGCA<br>
 +
                              C</font><font color="#ff0000">A</font><font color="#0000ff">GCTGCGATAGCGTCATGCGTGTGTCAG</font><font color="#ff0000">A</font><font color="#38761d">GTGCACTGTC<br>
 +
                            ACAT</font></td>
 
                         </tr>
 
                         </tr>
 
                         <tr>
 
                         <tr>
−
                        <td>Trition X-100</td>
+
                            <td>O5(30nt)</td>
−
                             <td>30 μL</td>
+
                             <td>
 +
                            ATGGCA<u>CCCAGTGGAGTTAGACCC</u>TGATTG
 +
                            </td>
 
                         </tr>
 
                         </tr>
−
                    </tbody>
+
                    </tbody>
−
                </table>
+
                  </table>
 +
              </div>
 +
              <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt="">
 +
              </div>
 +
            </div>
 +
          </div>
 +
          <div class="panel panel-transparent">
 +
            <div class="panel-heading">
 +
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis (PAGE)</h3></a></h4>
 +
            </div>
 +
            <div id="PAGE" class="panel-collapse collapse in">
 +
              <div class="panel-body">
 
                 <p class="text-justify" align="left"><font size="3">
 
                 <p class="text-justify" align="left"><font size="3">
−
                 <br>
+
                 The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded.
−
                <b>Steps</b><br>
+
                For analysis by 1% agarose gel, 10μL samples (10μM) are loaded.  
−
                1. Dilute 1M Tris buffer into 50mM by adding 5mL 1M Tris buffer to 95mL of distilled water.
+
                All the agarose gels are run at a constant voltage of 100V.  
−
                2. Dissolve 0.8g NH<sub>4</sub>Cl and 0.15g KCl into the solution.
+
                GelRed is used to prestained the gels.<br><br>
−
                3. Adjust pH of the solution to 7.5 by adding 1M HCl drop by drop with the aid of a pH meter.
+
                For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker.  
−
                4. Add 30μL of Triton X-100 to the solution and shake vigorously.
+
                The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel.  
−
                 </font></p>
+
                The PAGE is conducted at a constant voltage of 100V.  
 +
                GelRed is used to prestained the gel.
 +
                 </font></p>  
 
               </div>
 
               </div>
 
             </div>
 
             </div>
Line 496: Line 145:
 
           <div class="panel panel-transparent">
 
           <div class="panel panel-transparent">
 
             <div class="panel-heading">
 
             <div class="panel-heading">
−
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Cell"><h3>Cell culture</h3></a></h4>
+
               <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4>
 
             </div>
 
             </div>
−
             <div id="Cell" class="panel-collapse collapse">
+
             <div id="ABTS" class="panel-collapse collapse in">
 
               <div class="panel-body">
 
               <div class="panel-body">
−
              <h4>LB Agar</h4>
 
−
                <p class="text-justify" align="left"><font size="3">
 
−
                <br><b>Specification</b><br>
 
−
                A piece of LB Aagar (Antibiotic resistance: Chloramphenicol)<br>
 
−
                <b>Storage</b><br>
 
−
                4°C<br>
 
−
                </font></p>
 
−
                <table class="table">
 
−
                <thead>
 
−
                    <tr>
 
−
                        <th>Materials</th>
 
−
                            <th>Quantity</th>
 
−
                        </tr>
 
−
                    </thead>
 
−
                    <tbody>
 
−
                    <tr>
 
−
                        <td>Distilled water</td>
 
−
                            <td>~1 L</td>
 
−
                        </tr>
 
−
                        <tr>
 
−
                        <td>Agar</td>
 
−
                            <td>15 g</td>
 
−
                        </tr>
 
−
                        <tr>
 
−
                        <td>NaCl</td>
 
−
                            <td>10 g</td>
 
−
                        </tr>
 
−
                        <tr>
 
−
                        <td>Tryptone</td>
 
−
                            <td>10 g</td>
 
−
                        </tr>
 
−
                        <tr>
 
−
                        <td>Yeast Extract</td>
 
−
                            <td>5 g</td>
 
−
                        </tr>
 
−
                        <tr>
 
−
                        <td>Chloramphenicol (25 μg/mL)</td>
 
−
                            <td>Small amount</td>
 
−
                        </tr>
 
−
                    </tbody>
 
−
                </table>
 
 
                 <p class="text-justify" align="left"><font size="3">
 
                 <p class="text-justify" align="left"><font size="3">
−
                 <br><b>Steps</b><br>
+
                 ABTS assay is used to detect G-quadruplex.
−
                1. Mix thoroughly the above (except the antibodic) with 1L of distilled water.<br>
+
                DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH<sub>4</sub>Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5).  
−
                 2. Autoclave at 121°C for 15 minutes.<br>
+
                 The mixture is incubated at room temperature for 30 minutes in a shaker.  
−
                 3. Let the agar to cool down to 55°C in room condition.<br>
+
                 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL.  
−
                4. Add at a concentration 25ug/mL of chloramphenicol to the cooled agar. <br>
+
                 The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.<br><br>
−
                5. Aseptically, pour ~20mL LB agar per 10cm polystyrene Petri dish for the plates to growth <i>E. coli</i> DH10B. <br>
+
−
                 6. Cover with lid and allow the plates to cool for 30-60 minutes at room temperature, or until set. <br>
+
−
                7. Label the bottom of plates as with antibiotic resistance 'CmR' and store it plastic bags at 4°C. <br>
+
−
                8. For those with colonies, seal them with parafilm and store them separately at 4°C. <br>
+
 
                 </font></p>
 
                 </font></p>
 
               </div>
 
               </div>
Line 556: Line 160:
 
           </div>
 
           </div>
 
         </div>
 
         </div>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        Looking for more details? Click <a href="https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKU--DetailedProtocol.pdf">here</a> to explore!<br><br>
 +
        </font></p>
 
       </div>
 
       </div>
 
     </div>
 
     </div>

Latest revision as of 02:29, 20 October 2016

Notebook

Protocol

One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:

Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.

The following table shows the sequence of our tetrahedral DNA nanostructure. Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5. The colour code used is the same as that in the paper fold of the structure (below the table).

Oligo Sequence (5' to 3')
O1(97nt) CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCAC
TGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAG
TCGAGTGCTGCTGAGTA
O2(67nt) CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGT
GCGCTCATCGCACGATAGCAGACGACG
O3(84nt) TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACAT
AGACTGACACACGCATGACGCTATCGCAGCACGACTATCG
CGCG
O4(84nt) GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCA
CAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTC
ACAT
O5(30nt) ATGGCACCCAGTGGAGTTAGACCCTGATTG

Native Polyacrylamide gel electrophoresis (PAGE)

The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded. For analysis by 1% agarose gel, 10μL samples (10μM) are loaded. All the agarose gels are run at a constant voltage of 100V. GelRed is used to prestained the gels.

For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel. The PAGE is conducted at a constant voltage of 100V. GelRed is used to prestained the gel.

ABTS Assay

ABTS assay is used to detect G-quadruplex. DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H2O2 (12mM final) are added to the mixture, making the final volume to be 150μL. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.

Looking for more details? Click here to explore!


Copyright © 2016 HKU iGEM. All rights reserved.