Difference between revisions of "Team:Hong Kong HKU/Experiments"

(Prototype team page)
 
m
 
(12 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
{{Hong_Kong_HKU}}
 
 
<html>
 
<html>
 +
<style>
 +
#sideMenu
 +
{display:none; /* Disable the display of the annoying side main menu*/}
 +
#top_title
 +
{display:none; /* Disable the annoying title*/}
 +
#content
 +
{padding:0px; width:90%; margin-left:5%; margin-right:5%;background-color: rgba(255,255,255,0);}
 +
body
 +
{margin: 0;
 +
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
 +
font-size: 24px;
 +
color: #333333;
 +
background-color: #fafafa;
 +
background-image:url(https://static.igem.org/mediawiki/2016/a/ae/T--Hong_Kong_HKU--Background_image.png);
 +
background-position:center center;
 +
background-repeat:no-repeat;
 +
-moz-background-size: cover;
 +
background-size: cover;
 +
background-attachment:fixed;}
 +
.container
 +
{background-color: rgba(255,255,255,0.6);
 +
padding-top:80px;}
 +
p {font-size: 16px;}
 +
h1,h2,h3,h4,h5,h6 {color: #282828;}
 +
h1 {font-size:72px;} h2 {font-size:48px;} h3 {font-size:36px;}
 +
h4 {font-size:32px;} h5 {font-size:28px;} h6 {font-size:24px;}
 +
.panel-body{background-color:rgba(255, 255, 255, 0) !important;}
 +
.panel-heading{background-color:rgba(255, 255, 255, 0.7)  !important;}
 +
.panel-group{background-color:rgba(255, 255, 255, 0)  !important;}
 +
.panel-transparent{background-color:rgba(255, 255, 255, 0) !important;}
 +
.nav-pills>li.active>a{background-color:#93d66b !important;}
 +
.nav-pills>li>a:hover{background-color:#b2dd75 !important; color:#FFFFFF!important;}
 +
.nav-pills>li.active>a:hover{background-color:#93d66b !important;}
 +
</style>
 +
<head>
 +
<meta charset="utf-8">
 +
<meta http-equiv="X-UA-Compatible" content="IE=edge">
 +
<meta name="viewport" content="width=device-width, initial-scale=1">
 +
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 +
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 +
</head>
 +
</html>
 +
{{Hong_Kong_HKU/Header}}
 +
<html>
 +
<body>
 +
<div class="container" align="center">
 +
    <h2>Notebook</h2>
 +
    <ul class="nav nav-pills">
 +
      <li ><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook">Working Log</a></li>
 +
      <li class="active dropdown">
 +
          <a class="dropdown-toggle" data-toggle="dropdown" href="#">Experiments and Protocol<span class="caret"></span></a>
 +
            <ul class="dropdown-menu">
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra">DNA Nanostructure Assembly</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE">Native Polyacrylamide gel electrophoresis (PAGE)</a></li>
 +
              <li><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS">ABTS</a></li>
 +
            </ul>
 +
      </li>
 +
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Safety">Safety</a></li>
 +
    </ul>
 +
    <div class="tab-content">
 +
      <div id="Protocol" class="tab-pane fade in active">
 +
        <h3>Protocol</h3>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:
 +
        </font></p>
 +
        <div class="panel-group" id="ProtocolContent" role="tablist" aria-multiselectable="true">
 +
        <div class="panel panel-transparent">
 +
            <div class="panel-heading" role="tab">
 +
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#Tetra"><h3>DNA Nanostructure Assembly</h3></a></h4>
 +
            </div>
 +
            <div id="Tetra" class="panel-collapse collapse in">
 +
              <div class="panel-body">
 +
                <p class="text-justify" align="left"><font size="3">
 +
                Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl<sub>2</sub>, pH 8), making the final concentration of each oligo to be 10μM.
 +
                The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.<br><br>
 +
                The following table shows the sequence of our tetrahedral DNA nanostructure.
 +
                Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5.
 +
                The colour code used is the same as that in the paper fold of the structure (below the table).
 +
              </font></p>
 +
              <div class="table-responsive">
 +
                  <table class="table">
 +
                    <thead>
 +
                        <tr>
 +
                            <th>Oligo</th>
 +
                            <th>Sequence (5' to 3')</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td>O1(97nt)</td>
 +
                            <td><font color="#ff00ff">CTACTAGCTGCACG</font><font color="#ff0000">A</font><font color="#a500ff">CGTAG</font><font color="a4004f">T</font><font color="#00ffff">GGGTT<u>GGG</u></font><font color="#a4004f"><u>T</u></font><u>CTAACTCCAC</u><font color="#a4004f"><br>
 +
                                <u>T</u></font><font color="#00ffff"><u>GGG</u>TAGGG</font><font color="#ff00ff">T</font><font color="#a500ff">CGTCG</font><font color="#ff0000">A</font><font color="#ff994f">GCTCACGTGCGTCACGCGCGATAG<br>
 +
                            TCG</font><font color="#ff0000">A</font><font color="#ff00ff">GTGCTGCTGAGTA</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O2(67nt)</td>
 +
                            <td><font color="#a500ff">CTACG</font><font color="#ff0000">A</font><font color="#38761d">GTGATGACGAGACATGTGACAGTGCAC</font><font color="#ff0000">A</font><font color="#00ff00">CTATGT<br>
 +
                            GCGCTCATCGCACGATAGCAG</font><font color="#ff0000">A</font><font color="#a500ff">CGACG</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O3(84nt)</td>
 +
                            <td><font color="#ff994f">TGACGCACGTGAGC</font><font color="#ff0000">A</font><font color="#00ff00">CTGCTATCGTGCGATGAGCGCACAT<br>
 +
                              AG</font><font color="#ff0000">A</font><font color="#0000ff">CTGACACACGCATGACGCTATCGCAGC</font><font color="#ff0000">A</font><font color="#ff994f">CGACTATCG<br>
 +
                            CGCG</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O4(84nt)</td>
 +
                            <td><font color="#38761d">GTCTCGTCATCAC</font><font color="#ff0000">A</font><font color="#ff00ff">CGTGCAGCTAGTAGTACTCAGCAGCA<br>
 +
                              C</font><font color="#ff0000">A</font><font color="#0000ff">GCTGCGATAGCGTCATGCGTGTGTCAG</font><font color="#ff0000">A</font><font color="#38761d">GTGCACTGTC<br>
 +
                            ACAT</font></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>O5(30nt)</td>
 +
                            <td>
 +
                            ATGGCA<u>CCCAGTGGAGTTAGACCC</u>TGATTG
 +
                            </td>
 +
                        </tr>
 +
                    </tbody>
 +
                  </table>
 +
              </div>
 +
              <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/8/83/T--Hong_Kong_HKU--TetraDesign2.png" alt="">
 +
              </div>
 +
            </div>
 +
          </div>
 +
          <div class="panel panel-transparent">
 +
            <div class="panel-heading">
 +
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#PAGE"><h3>Native Polyacrylamide gel electrophoresis (PAGE)</h3></a></h4>
 +
            </div>
 +
            <div id="PAGE" class="panel-collapse collapse in">
 +
              <div class="panel-body">
 +
                <p class="text-justify" align="left"><font size="3">
 +
                The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded.
 +
                For analysis by 1% agarose gel, 10μL samples (10μM) are loaded.
 +
                All the agarose gels are run at a constant voltage of 100V.
 +
                GelRed is used to prestained the gels.<br><br>
 +
                For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker.
 +
                The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel.
 +
                The PAGE is conducted at a constant voltage of 100V.
 +
                GelRed is used to prestained the gel.
 +
                </font></p>
 +
              </div>
 +
            </div>
 +
          </div>
 +
          <div class="panel panel-transparent">
 +
            <div class="panel-heading">
 +
              <h4 class="panel-title"><a data-toggle="collapse" data-parent="#ProtocolContent" href="#ABTS"><h3>ABTS Assay</h3></a></h4>
 +
            </div>
 +
            <div id="ABTS" class="panel-collapse collapse in">
 +
              <div class="panel-body">
 +
                <p class="text-justify" align="left"><font size="3">
 +
                ABTS assay is used to detect G-quadruplex.
 +
                DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH<sub>4</sub>Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5).
 +
                The mixture is incubated at room temperature for 30 minutes in a shaker.
 +
                100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL.
 +
                The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.<br><br>
 +
                </font></p>
 +
              </div>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        Looking for more details? Click <a href="https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKU--DetailedProtocol.pdf">here</a> to explore!<br><br>
 +
        </font></p>
 +
      </div>
 +
    </div>
 +
  </div>
  
−
<div class="column full_size">
+
<!-- footer -->
−
 
+
<footer class="text-center"></footer>
−
 
+
<script src="https://2016.igem.org/Team:Hong_Kong_HKU/JS/jQuery?action=raw&ctype=text/javascript" type="text/javascript"></script>
−
<p>Describe the experiments, research and protocols you used in your iGEM project.</p>
+
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script>
−
 
+
</body>
−
</div>
+
−
 
+
−
<div class="column half_size">
+
−
<h5>What should this page contain?</h5>
+
−
<ul>
+
−
<li> Protocols </li>
+
−
<li> Experiments </li>
+
−
<li>Documentation of the development of your project </li>
+
−
</ul>
+
−
 
+
−
</div>
+
−
 
+
−
<div class="column half_size">
+
−
<h5>Inspiration</h5>
+
−
<ul>
+
−
<li><a href="https://2014.igem.org/Team:Colombia/Protocols">2014 Colombia </a></li>
+
−
<li><a href="https://2014.igem.org/Team:Imperial/Protocols">2014 Imperial </a></li>
+
−
<li><a href="https://2014.igem.org/Team:Caltech/Project/Experiments">2014 Caltech </a></li>
+
−
</ul>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="clear"></div>
+
−
 
+
−
 
+
−
<div class="column half_size">
+
−
 
+
−
 
+
−
 
+
−
</div>
+
−
 
+
 
</html>
 
</html>
 +
{{Hong_Kong_HKU/Footer}}

Latest revision as of 02:29, 20 October 2016

Notebook

Protocol

One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:

Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.

The following table shows the sequence of our tetrahedral DNA nanostructure. Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5. The colour code used is the same as that in the paper fold of the structure (below the table).

Oligo Sequence (5' to 3')
O1(97nt) CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCAC
TGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAG
TCGAGTGCTGCTGAGTA
O2(67nt) CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGT
GCGCTCATCGCACGATAGCAGACGACG
O3(84nt) TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACAT
AGACTGACACACGCATGACGCTATCGCAGCACGACTATCG
CGCG
O4(84nt) GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCA
CAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTC
ACAT
O5(30nt) ATGGCACCCAGTGGAGTTAGACCCTGATTG

Native Polyacrylamide gel electrophoresis (PAGE)

The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded. For analysis by 1% agarose gel, 10μL samples (10μM) are loaded. All the agarose gels are run at a constant voltage of 100V. GelRed is used to prestained the gels.

For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel. The PAGE is conducted at a constant voltage of 100V. GelRed is used to prestained the gel.

ABTS Assay

ABTS assay is used to detect G-quadruplex. DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H2O2 (12mM final) are added to the mixture, making the final volume to be 150μL. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.

Looking for more details? Click here to explore!


Copyright © 2016 HKU iGEM. All rights reserved.