Difference between revisions of "Team:Hong Kong HKU/Proof"

m
 
(2 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
<html>
 
<html>
<meta http-equiv="X-UA-Compatible" content="IE=edge">
 
<meta name="viewport" content="width=device-width, initial-scale=1.0">
 
 
<style>
 
<style>
        #sideMenu
+
#sideMenu
        {
+
{display:none; /* Disable the display of the annoying side main menu*/}
        display:none; /* Disable the display of the annoying side main menu*/
+
#top_title
        }
+
{display:none; /* Disable the annoying title*/}
       
+
#content
        #top_title
+
{padding:0px; width:90%; margin-left:5%; margin-right:5%;background-color: rgba(255,255,255,0);}
        {
+
body
        display:none; /* Disable the annoying title*/
+
{margin: 0;
        }
+
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
 
+
font-size: 24px;
#content { padding:0px; width:90%; margin-left:5%; margin-right:5%;}
+
color: #333333;
 +
background-color: #fafafa;
 +
background-image:url(https://static.igem.org/mediawiki/2016/a/ae/T--Hong_Kong_HKU--Background_image.png);
 +
background-position:center center;
 +
background-repeat:no-repeat;
 +
-moz-background-size: cover;
 +
background-size: cover;
 +
background-attachment:fixed;}
 +
.container
 +
{background-color: rgba(255,255,255,0.6);
 +
padding-top:80px;}
 +
p {font-size: 16px;}
 +
h1,h2,h3,h4,h5,h6 {color: #282828;}
 +
h1 {font-size:72px;} h2 {font-size:48px;} h3 {font-size:36px;}
 +
h4 {font-size:32px;} h5 {font-size:28px;} h6 {font-size:24px;}
 +
.nav-pills>li.active>a{background-color:#93d66b !important;}
 +
.nav-pills>li>a:hover{background-color:#b2dd75 !important; color:#FFFFFF!important;}
 +
.nav-pills>li.active>a:hover{background-color:#93d66b !important;}
 
</style>
 
</style>
 
 
<head>
 
<head>
 
<meta charset="utf-8">
 
<meta charset="utf-8">
 
<meta http-equiv="X-UA-Compatible" content="IE=edge">
 
<meta http-equiv="X-UA-Compatible" content="IE=edge">
 
<meta name="viewport" content="width=device-width, initial-scale=1">
 
<meta name="viewport" content="width=device-width, initial-scale=1">
<!-- Bootstrap -->
 
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/default?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
<!-- custom style -->
 
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
<link href="https://2016.igem.org/Team:Hong_Kong_HKU/css/custom?action=raw&ctype=text/css" type="text/css" rel="stylesheet">
 
</head>
 
</head>
 
+
</html>
 +
{{Hong_Kong_HKU/Header}}
 +
<html>
 
<body>
 
<body>
<nav class="navbar navbar-default">
+
<div class="container" align="center">
  <div class="container-fluid">  
+
    <h2>Proof</h2>
    <!-- Brand and toggle get grouped for better mobile display -->
+
    <ul class="nav nav-pills">
     <div class="navbar-header">
+
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Parts#Parts">Parts</a></li>
       <button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1" aria-expanded="false"> <span class="sr-only">Toggle navigation</span> <span class="icon-bar"></span> <span class="icon-bar"></span> <span class="icon-bar"></span> </button>
+
      <li><a data-toggle="pill" href="https://2016.igem.org/Team:Hong_Kong_HKU/Parts#Achievements">Achievements</a></li>
      <a class="navbar-brand" href="#">HKU iGEM Team</a>
+
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">Results</a></li>
 +
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Demonstrate">Demonstrate our work</a></li>
 +
      <li class="active"><a data-toggle="pill" href="#">Proof of Concept</a></li>
 +
    </ul>
 +
     <div class="tab-content">
 +
       <div id="inspiration" class="tab-pane fade in active">
 +
    <p class="text-justify" align="left"><font size="3">
 +
        <br>
 +
        We used DNA to test our probe in the beginning due to two main considerations - price and stability. 
 +
        RNA is a lot more expensive than DNA strands, and at the same time, RNA degrades much more rapidly upon exposure to the environment in the presence of RNA nucleases.<br><br>
 +
        We first used DNA inputs to prove our nanostructure being functional and to optimise our testing methods.<br><br>
 +
        We took special precautions and methods when we did experiments for concept proof with RNA strands
 +
        e.g. use of fume cupboards and DEPC-treated water.<br><br>
 +
        </font>
 +
        <font size="4"><b>PAGE for strand displacement</b></font><br><br>
 +
        <font size="3">
 +
        We replicated the same protocol with replacement of DNA input and mutant input by RNA versions.
 +
        The sequences of the 2 sets of input and mutant input were the same.<br><br>
 +
        </font></p>
 +
        <table class="table">
 +
        <thead>
 +
            <tr>
 +
                <th>Input</th>
 +
                    <th>Sequence</th>
 +
                    <th>Length (nt)</th>
 +
                </tr>
 +
            </thead>
 +
            <tbody>
 +
            <tr>
 +
                <td>RNA Input</td>
 +
                    <td>CAAUCAGGGUCUAACUCCACUGGGUGCCAU</td>
 +
                    <td>30</td>
 +
                </tr>
 +
            <tr>
 +
                <td>Random RNA</td>
 +
                    <td>CAGGCAGUAUCAUGCGACAUUGGGUGCAGC</td>
 +
                    <td>30</td>
 +
                </tr>
 +
            </tbody>
 +
        </table>
 +
        <br>
 +
        <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/6/61/T--Hong_Kong_HKU--Proof1.jpg" alt="" width="400px" height="auto">
 +
        <br>
 +
        <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/0/06/T--Hong_Kong_HKU--Proof2.jpg" alt="" width="400px" height="auto">
 +
        <br>
 +
        <p class="text-justify" align="left">
 +
        <font size="3">
 +
        12% acrylamide gels showing the strand displacement effect with the correct and random inputs - RNA (left) and DNA (right)<br><br>
 +
       
 +
        With the comparisons above, clearly strand displacement was successful with RNA inputs.<br><br>
 +
        </font>
 +
        <font size="4"><b>ABTS Assay for G-quadruplex formation</b></font><br><br>
 +
        <font size="3">
 +
        After showing that our DNA nanostructures can detect our target DNA, we went further to detect RNA.
 +
        This test aimed to simulate the detection of serum miRNA, which has great potential in disease diagnosis as miRNA are promising disease biomarkers.
 +
        The same sequence of RNA input as on the above was used in the assay.<br><br>
 +
        First, we used our simplified DNA nanostructure (formed from the G-quadruplex side of O1 and O5 of the tetrahedron, 
 +
        which is the essential part of the 3D tetrahedral nanostructure) to detect RNA input.
 +
        Equimolar (100nM final) DNA nanostructure and RNA input were added in the assay.
 +
        The following bar chart shows the absorbance after the addition of different inputs.<br><br>
 +
        </font></p>
 +
        <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/5/59/T--Hong_Kong_HKU--O1O5RNAmutant.png" alt="" width="800px" height="auto">
 +
        <p class="text-justify" align="left">
 +
        <font size="3">
 +
        Absorbance at 420nm after the addition of different inputs to the simplified DNA nanostructure (formed from O1's G-quadruplex side and O5 of the tetrahedron) which is termed as  "beacon"  in the above graph.
 +
        The absorbance was taken 15 minutes after the addition of ABTS and H<sub>2</sub>O<sub>2</sub>.
 +
        Error bars show standard deviation from triplicates.<br><br>
 +
        Then, we repeated the experiment using our tetrahedral DNA nanostructure, which gave the following result.<br><br>
 +
        </font></p>
 +
        <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/7/7f/T--Hong_Kong_HKU--TetraRNAmutant.png" alt="" width="800px" height="auto">
 +
        <p class="text-justify" align="left">
 +
        <font size="3">
 +
        Absorbance at 420nm after the addition of different inputs to the tetrahedral DNA nanostructure.
 +
        The absorbance was taken 15 minutes after the addition of ABTS and H<sub>2</sub>O<sub>2</sub>.
 +
        Error bars show standard deviation from triplicates.<br><br>
 +
        From the above two graphs, it is clear that the addition of RNA input resulted in a higher absorbance than that without the addition of RNA input, whereas the addition of a random RNA sequence did not lead to a higher absorbance.
 +
        Hence, we have successfully demonstrated that our design can distinguish the correct input (DNA or RNA) from random sequences. <br><br>
 +
        Our DNA nanostructures can potentially be utilized as a simple diagnostic tool, where a higher absorbance in ABTS assay suggests the presence of our desired DNA or RNA target.
 +
        We can easily expand the application to detect other DNA or RNA sequences by modifying the sequence of two strands at the detecting edge of the DNA nanostructure.<br><br>
 +
        </font></p>
 +
      </div>
 
     </div>
 
     </div>
     
+
</div>
   
+
    <!-- Collect the nav links, forms, and other content for toggling -->
+
    <div class="collapse navbar-collapse" id="bs-example-navbar-collapse-1">
+
      <ul class="nav navbar-nav">
+
        <li class="active"><a href="https://2016.igem.org/Team:Hong_Kong_HKU">Homepage</a> </li>
+
        <li class="dropdown"> <a href="#" class="dropdown-toggle" data-toggle="dropdown" role="button" aria-expanded="false" aria-haspopup="true">Project<span class="caret"></span></a>
+
          <ul class="dropdown-menu">
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Description">Description</a> </li>
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Design">Design</a> </li>
+
            <li role="separator" class="divider"></li>
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Proof">Proof of concept</a> </li>
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Demonstrate">Demonstrate</a> </li>
+
          </ul>
+
        </li>
+
        <li class="dropdown"> <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Notebook" class="dropdown-toggle" data-toggle="dropdown" role="button" aria-expanded="false" aria-haspopup="true">Notebook<span class="caret"></span></a>
+
          <ul class="dropdown-menu">
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Protocol">Protocol</a> </li>
+
            <li role="separator" class="divider"></li>
+
            <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">Results</a> </li>
+
          </ul>
+
        </li>
+
        <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Parts">Parts</a></li>
+
        <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Human_Practices">Human Practices</a></li>
+
        <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Collaborations">Collaborations</a></li>
+
        <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Attributions">Attributions</a></li>
+
      </ul>
+
      <form class="navbar-form navbar-right" role="search">
+
        <div class="form-group">
+
        <a href="https://www.facebook.com/igemhku2016" target="_blank"><img style="float:right"  src="https://static.igem.org/mediawiki/2016/e/ea/T--Hong_Kong_HKU--FB.jpg" width="24px" height="24px" alt="Placeholder image"></a>
+
        </div>
+
      </form>
+
      <ul class="nav navbar-nav navbar-right">
+
      </ul>
+
    </div>
+
    <span class="dropdown"></span>    <!-- /.navbar-collapse -->
+
  </div>
+
  <!-- /.container-fluid -->
+
</nav>
+
 
+
 
+
<img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/a/a8/T--Hong_Kong_HKU--Logo_HKU_2460x1860.jpg" style="width:240px; height:180px;" alt="Placeholder image">
+
<div class="container" align="center">
+
<h3>Proof of Concept</h3>
+
  
 
<!-- footer -->
 
<!-- footer -->
<hr>
+
<footer class="text-center"></footer>
<footer class="text-center">
+
<script src="https://2016.igem.org/Team:Hong_Kong_HKU/JS/jQuery?action=raw&ctype=text/javascript" type="text/javascript"></script>
  <div class="container">
+
  <table cellspacing="0" cellpadding="0" max-width="90%" height="78" border="0" align="center">
+
  <tbody>
+
    <tr align="center">
+
      <td width="70%"><h4>Sponsors</h4></td>
+
      <td width="20%"><h4>Contact</h4></td>
+
    </tr>
+
    <tr>
+
      <td><img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/c/cd/T--Hong_Kong_HKU--IDT-Logo.png" width="185px" height="51px" alt="Placeholder image">
+
      <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/7/76/T--Hong_Kong_HKU--SnapGeneLogo72.jpg" width="180px" height="51px" alt="Placeholder image"></td>
+
      <td>Email: <a href="mailto:igemhku@hku.hk" target="_blank">igemhku@hku.hk</a></td>
+
    </tr>
+
  </tbody>
+
</table>
+
    <div class="row">
+
      <div class="col-xs-12">
+
        <p style="text-align: center;">Copyright © 2016 HKU iGEM. All rights reserved.</p>
+
      </div>
+
    </div>
+
  </div>
+
</footer>
+
 
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script>
 
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script>
 
 
</body>
 
</body>
 
 
</html>
 
</html>
 +
{{Hong_Kong_HKU/Footer}}

Latest revision as of 14:32, 25 November 2016

Proof


We used DNA to test our probe in the beginning due to two main considerations - price and stability. RNA is a lot more expensive than DNA strands, and at the same time, RNA degrades much more rapidly upon exposure to the environment in the presence of RNA nucleases.

We first used DNA inputs to prove our nanostructure being functional and to optimise our testing methods.

We took special precautions and methods when we did experiments for concept proof with RNA strands e.g. use of fume cupboards and DEPC-treated water.

PAGE for strand displacement

We replicated the same protocol with replacement of DNA input and mutant input by RNA versions. The sequences of the 2 sets of input and mutant input were the same.

Input Sequence Length (nt)
RNA Input CAAUCAGGGUCUAACUCCACUGGGUGCCAU 30
Random RNA CAGGCAGUAUCAUGCGACAUUGGGUGCAGC 30



12% acrylamide gels showing the strand displacement effect with the correct and random inputs - RNA (left) and DNA (right)

With the comparisons above, clearly strand displacement was successful with RNA inputs.

ABTS Assay for G-quadruplex formation

After showing that our DNA nanostructures can detect our target DNA, we went further to detect RNA. This test aimed to simulate the detection of serum miRNA, which has great potential in disease diagnosis as miRNA are promising disease biomarkers. The same sequence of RNA input as on the above was used in the assay.

First, we used our simplified DNA nanostructure (formed from the G-quadruplex side of O1 and O5 of the tetrahedron, which is the essential part of the 3D tetrahedral nanostructure) to detect RNA input. Equimolar (100nM final) DNA nanostructure and RNA input were added in the assay. The following bar chart shows the absorbance after the addition of different inputs.

Absorbance at 420nm after the addition of different inputs to the simplified DNA nanostructure (formed from O1's G-quadruplex side and O5 of the tetrahedron) which is termed as "beacon" in the above graph. The absorbance was taken 15 minutes after the addition of ABTS and H2O2. Error bars show standard deviation from triplicates.

Then, we repeated the experiment using our tetrahedral DNA nanostructure, which gave the following result.

Absorbance at 420nm after the addition of different inputs to the tetrahedral DNA nanostructure. The absorbance was taken 15 minutes after the addition of ABTS and H2O2. Error bars show standard deviation from triplicates.

From the above two graphs, it is clear that the addition of RNA input resulted in a higher absorbance than that without the addition of RNA input, whereas the addition of a random RNA sequence did not lead to a higher absorbance. Hence, we have successfully demonstrated that our design can distinguish the correct input (DNA or RNA) from random sequences.

Our DNA nanostructures can potentially be utilized as a simple diagnostic tool, where a higher absorbance in ABTS assay suggests the presence of our desired DNA or RNA target. We can easily expand the application to detect other DNA or RNA sequences by modifying the sequence of two strands at the detecting edge of the DNA nanostructure.


Copyright © 2016 HKU iGEM. All rights reserved.