• For "intramolecular" ligation of a PCR product the 5'-ends are phosphorylated with T4 Polynucleotidekinase (PNK)
• Set up the following reaction:

reagent	volume [ µL]
10x T4 DNA ligase buffer	2.5
T4 PNK	1
PEG 4000 50% (w/v)	2.5
DNA (100 to 600 ng)	x
ddH2O	to 25

• Incubate at 37 °C, 30 min
• Heat inactivate at 65 °C, 20 min
• Add 1 µL T4 DNA ligase after reaction has cooled down to room temperature
• Incubate at room temperature for at least 2 h, overnight also works.
• Next step: Transformation via heat shock

• One Reaction mix contains
• 5 µL 5x GoTaq buffer (Promega)
• 1 µL MgCl₂ (25 mM stock)
• 0.5 µL dNTPs (10 mM each)
• 0.25 µL primer mix (prefix/suffix primers or sequencing primers) 100 mM
• 17.625 µL ddH₂O
• 0.125 µL GoTaq polymerase (Promega)
• 0.5 µL template
• PCR program
• Cell lysis and denaturation: 5 min, 95 °C
• 30 cycles
• Denaturation: 10 s, 95 °C
• Hybridisation: 30 s, annealing temperature
• Elongation: 60 s/kb of product, 72 °C
• Final elongation: 5 min, 72 °C
• Template alternatives
• Pick a colony with sterile tip, elute in 100 µL ddH₂O or buffer, store at 4 °C during PCR, plate if insert is of correct size
• Pick colony, streak at marked position on a new plate and solute remaining cells on the tip in the PCR tube with reaction mixture, cultivate if insert is of correct size
• Gel electrophoresis for control of fragment size

• Generate the complenentary sequence overlaps by PCR using the Phusion DNA-polymerase. If necessary add 5 M Betain in the reaction mix by reducing the amount of H₂O to decrease the number of false PCR products.
• Seperate the PCR product of interest by gel electrophoresis, extract the products via Gel Extraction.

• Preparing assembly mixture
• 320 µL 5x isothermal reaction buffer
• 0.64 µL of 10 U ml^-1 T5 exonuclease (for DNA molecules overlapping by greater than 150 bp add 3.2 µL of 10 U mL^-1 T5 exonuclease)
• 20 µL of 2 U mL^-1 Phusion DNA polymerase
• 160 µL of 40 U mL^-1 taq DNA ligase
• add ddH₂O up to a final volume of 1.2 mL
• Aliquote 15 µL of the assembly mixture and store at -20 °C
• That 15 µL assembly mixture on ice until use
• Add 5 µL of the purified DNA molecules in equimolar amounts (between 10 and 100 ng of each fragment).
• Incubate the mixture at 50 °C for 15 to 60 min with 60 min being optimal.

• Q5
• Q5 master mix (25 µL)
• 5 µL 5 x Q5 buffer
• 0.5 µL 10 mM dNTPs
• Up to 50 ng*µL^-1template
• 0.1 µL Q5 DNA polymerase
• 0.5-1 µL primer 10 µM each
• Ad 25 µL dH₂O
• Q5 standard protocol
• Initial denaturation: 98°C - 30 s
• 30-35 cycles of
• Denaturation: 98 °C - 20 s
• Annealing: 50-75 °C - 30 s
• Elongation: 72 °C - 20 s/kb
• Final elongation: 72 °C - 5 min
• Storage: 4 °C

• Modified from Silver Lab
• Minimum size of the BioBricks for this methods is 150 bp, whereas it should be at least 500 bp bigger or smaller than the used backbone. The BioBricks, which complies with these conditions, is used as the insert and is assembled into the prefix or suffix of the other BioBrick called vector. The methods differ in prefix and suffix insertion.
• Suffix insertion
• Digestion of inserted Biobrick
• Acquire > 700 ng DNA (10 µL volume)
• Add 1 µL 10 x NEBuffer
• Add 0.5 µL XbaI
• Add 0.5 µL PstI
• Digest 1 h at 37 °C
• Inactivate 20 min at 80 °C
• Clean up via gel electrophoresis, cut and extract from gel
• Digestion of the vector
• Acquire about 700 ng DNA (10 µL volume)
• Add 1 µL 10 x NEBuffer 2.1
• Add 0.5 µL SpeI
• Add 0.5 µL PstI
• Digest 1 h at 37 °C
• Inactivate 20 min at 80 °C
• Add 1 µL Antarctic Phosphatase (AP) and 1.2 µL 10 x AP reaction buffer
• Incubate 1 h at 37°C
• Clean up with PCR clean up kit
• Ligation
• Mix 50-200 ng vector with 3-10 fold molar access of insert
• Add 2 µL T4-Ligase-Buffer, 1 µL T4-DNA-Ligase
• Incubate for a minimum 20-30 min at room temperature (we usually ligate over night)
• Inactivate 5 min at 70 °C
• Store at -20 °C or transform
• Prefix insertion
• Follow protocol of Suffix insertion, replace the restriction enzymes as following:
• Digest insert with EcoRI and SpeI
• Digest vector with EcoRI and XbaI

• Thaw 50 µL electrocompetent E. coli cells on ice, dilute with icecold 50 µL glycerine (10%) if necessary
• Add 0.5-5 µL plasmid to 50 µL electrocompetent cells
• Store cells on ice for 1 minute
• Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ω
• Transfer transformation reaction to 450 µL SOC-Medium and incubate 1 h at 37 °C
• Plate on selective LB-Medium
• Incubate over night at 37 °C

• Thaw 100 µL chemo competent E. coli cells on ice
• Add 0.5-5 µL plasmid to 100 µl chemocompetent cells
• Store cells on ice for 10-30 min on ice
• Heat shock for 90 seconds at 42 °C
• Store reaction on ice for 60 seconds
• Optional: Preheat SOC medium to 37 °C
• Transfer reaction to 1 ml SOC medium and incubate at 37 °C for at least 1 hour
• Centrifuge 3 minutes at 12000 rpm and plate on selective LB medium
• Incubate at 37 °C over night

• For 2 resolving gel (14 %):
• 4.7 mL Bisacrylamid/Acrylamid (0.8 %; , 30 %;, at the ratio of 37.5:1)
• 2.7 mL H₂O
• 2.5 mL 0.5 M TRIS-HCl, pH 6.8
• 0.1 mL 10% SDS

• 1.3 mL Bisacrylamid/Acrylamid (0.8 %; , 30 %;, at the ratio of 37.5:1)
• 6.1 mL H₂O
• 2.5 mL 0.5 M TRIS-HCl, pH 6.8
• 0.1 mL 10% SDS
• 50 µL 10 % ammonium persulfate
• 5 µL TEMED

• Remove sealing and store the gel wrapped in moistened paper towel at 4 °C.

• Mix your protein mixture 3:1 with PBJR buffer (15 µL protein solution + 5 µL PBJR buffer)
• Heat for 5 minutes at 95 °C

• Remove sealing, put the polymerized gel into gel box and pour 1x SDS-PAGE running buffer into the negative and positive electrode chamber.
• Remove comp without destroying the gel pockets.
• Pipet the SDS running buffer in the gel pockets up and down for flushing the gel pockets.
• Pipet slowly 20 µL of the sample into the gel pockets.
• Make sure to include at least one lane with molecular weight standards (PageRuler Prestained Protein Ladder™ (Fa. Fermentas)) to determinate the molecular weight of the sample.
• Connect the power lead and run the gel with 180 V until the distance of the lowest molecular weight standard lane to the gel end is down to 0.5 cm.

• After finishing the SDS-PAGE remove gel from gel casting form and transfer it into a box.
• Add 100 mL of the Colloidal Coomaassie Brilliant Blue staining solution to your polyacrylamid gel.
• Incubate the gel in the solution at room temperature until the protein bands got an intensive blue color. Shake the gel continuously during incubation.
• Remove the staining solution.
• Wash the gel with destaining buffer.
• Incubate the gel in H₂O (2-6 h) for bleaching the background. Shake the gel continuously during incubation. If necessary replace the colored water with new one.

• Be careful that skin scales or hair do not contaminate your sample. So wear hand gloves and tie up your hair.
• Reaction tubes have to be cleaned with 60 % (v/v) CH₃CN and 0.1 % (v/v) TFA. Afterwards the solution has to be removed completely followed by evaporation of the tubes under a fume hood. Alternatively, microtiter plates from Greiner® (REF 650161) can be used without washing. If you work with reaction tubes from Eppendorf, you do not need the wash step either.
• Cut out the protein lanes of a Coomassie-stained SDS-PAGE using a clean scalpel. Gel parts are transferred to the washed reaction tubes. If necessary, cut the parts to smaller slices
• Gel slices should be washed two times. Therefore add 200 µL 30 % (v/v) acetonitrile in 0.1 M ammonium hydrogen carbonate each time and shake lightly for 20 minutes till the gel slices are destained. Remove supernatant and discard to special waste
• Dry gel slices at least 30 minutes in a Speedvac.
• Rehydrate gel slices in 15 µL trypsin solution followed by short centrifugation.
• Trypsin-solution: 1 µL trypsin + 14 µL 10 mM NH₄HCO₃
• For this solution solubilize lyophilized trypsin in 200 µl of provided buffer and activate Trypsin for 15 minutes at 30 °C. For further use it can be stored at -20 °C.
• Gel slices have to be incubated 30 minutes at room temperature, followed by incubation at 37 °C overnight
• Dry gel slices at least 60 minutes in a Speedvac.
• According to the size of the gel slice, add 5 - 20 µL 50 % (v/v) ACN / 0.1 % (v/v) TFA
• Samples can be used for MALDI measurement or stored at -20 °C

• Spot 0.5 - 1 µL of sample aliquot
• Add 1 µL HCCA matrix solution to the spotted sample aliquots. Pipet up and down approximately five times to obtain a sufficient mixing. Be careful not to contact the AnchorChip. Note: Most of the sample solvent needs to be gone in order to achieve a sufficiently low water content. When the matrix solution is added to the previously spotted sample aliquot at a too high water content in the mixture, it will result in undesired crystallization of the matrix outside the anchor spot area.
• Dry the prepared spots at room temperature
• Spot external calibrants on the adjacent calibrant spot positions. Use the calibrant stock solution (Bruker’s “Peptide Calibration Standard II”, Part number #222570), add 125 µL of 0.1 % TFA (v/v) in 30 % ACN to the vial. Vortex and sonicate the vial.
• Mix the calibrant stock solution in a 1:200 ratio with HCCA matrix and deposit 1 µL of the mixture onto the calibrant spots.
• Analyze samples in ultrafleXtreme by Bruker Daltonics.

• Preparing immune-tubes for phage panning:
• Dilute 45 μg of your target protein in 1.5 mL 1 M NaHCO3
• Incubate rolling over night at 4 °C and discard the rest
• Coat free surfaces by incubating 1 h filled with 5 mg/mL BSA
• Wash three times with PBST
• Store at 4 °C in the dark


• Phagemid display:
• Insert a variable library of binding protein CDSs in the phagemid vector pAK100 by Gibson or restriction cloning
• Transformate the vector in E. coli ER2738
• Remaining colonies form the phagemid library, screened for binders in the following procedure
• Wash up all colonies with 5 mL LB and inoculate 200 mL LB, containing chloramphenicol, up to OD 0.1
• Incubate the culture, shaking at 37°C, up to OD 0.5
• Add 10 x Phages per E. coli cell to infect the bacteria
• Incubate 1.5 h at 37°C, then add kanamycin
• Incubate further 1.5 h at 37°C
• Centrifuge at 5,000 g for 10 min and decant the supernatant
• Add 25 %vol PEG NaCl and mix well
• Precipitation of produced phages at 4 °C, over night
• Centrifuge at 12,000 g and 4°C for 30 min and discard the supernatant
• Resuspend the pellet with 3 mL PBS and centrifuge at 13,000 g and room temperature for 10 min and decant the supernatant
• Add 20 %vol PEG NaCl and precipitate for 1 h on ice
• Centrifuge at 4 °C and 13,000 g for 10 min and discard supernatant
• Resuspend the pellet in 500 μL PBS
• Centrifuge at 13,000 g and room temperature for 10 min
• Measure UV-VIS absorbance of an 1:50 aliquot at 269 nm and 320 nm to calculate the phage concentration
• Add 1x1012 to 5x1012 Phages diluted in 1 mL PBST containing 1 mg/mL BSA on the prepared immune-tubes and incubate rolling at 4°C for 1 h
• Wash the immune-tubes carefully with PBST for at least 10 times and discard the washing buffer
• Eluate remaining phages by adding 1 mL Glycine-HCl, containing 1 mg/mL BSA by incubating rolling for 10 min at room temperature
• Neutralize the eluate by adding 150 μL TRIS at pH 9
• Add 10 μL eluted phages to 140 μL of E. coli ER2738 at OD 0.5, incubate for 10 min at room temperature and streak out at LB agar containing tetracycline and chloramphenicol

• Required solutions:
• 5x EMSA buffer (100 mM Na₂HPO₄, 375 mM KCl, 25 % Glycerol, adjust ph to 8.0)
• EMSA running buffer (20 mM Na₂HPO₄, adjust ph to 8.0)
• 3 % agarose gel prepared with EMSA running buffer
• MgCl₂: 25 mM
• EDTA: 2,5 mM
• BSA: 10 mg/ml
• Dithiotreitol
• salmon sperm
• Cy3 labeled DNA
• protein
• Reaction:
• 0.05 pmol Cy3 labeled DNA
• 5 pmol purified protein of interest
• 4 µl 5x EMSA buffer
• 2 µl MgCl₂ final concentration: 2.5 mM
• 0.8 µl EDTA final concentration: 0.1 mM
• 1 µl BSA final amount: 10 µg
• 1 µl salmon sperm final amount: 1 µg
• optional: 5 mM DTT
• mix all components of the reaction carefully and add up with water to 20 µl H₂O.
• Incubate at room temperature in the dark for 15 min.
• Keep in mind that Cy3 is light sensitive, always keep your samples in the dark after addition of the DNA fragment.
• Apply reaction to 3 % agarose gel.
• Run gel at 80 V for approximately 80 min at 4 °C. (Adjust voltage and duration to size of your DNA fragement.)
• Detect Cy3 with a fluorescence scanner. In our case it was the Typhoon 8600 variable Mode Imager.

• Design of the guide RNA: 20 nt of interest with 3' protospacer adjacent sequence (PAM) NGG, where N is any nucleotide. Preference is given to:
  • sequences with purines occupying the last four (3') bases of the protospacer.
  • sequences on the non-coding strand.
  • sequences in which the last 12 nt protospacer + 3 nt PAM (15 nt total) are unique in the genome (check by BLAST with all four possible NGG sequences)
• For knock-out of the rpoZ gene of E. coli the following sequence can be used:
  • 5'- CGACCAGTACCAGGTCAAAACGG -3'
• Design two 24 nt oligonucleotide (4 nt 5' sticky end + 20 nt spacer sequence) with the sticky ends ACGC on the forward primer and AAAC on the reverse primer. For the rpoZ knock-out the two primers are:
  • Guide-fw: 5'-ACGCCGACCAGTACCAGGTCAAAA-3'
  • Guide-rv: 5'-AAACTTTTGACCTGGTACTGGTCG-3'
  The sticky ends are designed for the BbsI sites.
• For single spacer, anneal single spacer oligos as follows:
  • Resuspend both oligos to 100µM in water
  • Mix 5µl Guide-for + 5µl Guide-rev + 90 µl 30mM HEPES, pH 7.8
  • Heat to 95°C for 5min, then ramp to 4°C at 0.1°C/sec
• Insert annealed spacer by Golden Gate assembly,
  Golden Gate reaction mixture:

  • Backbone	X µl	100 ng
    Insert	0.3 µl	From 10-fold diluted annealed oligo stock
    T4 Ligase Buffer (NEB)	2 µl
    T4 Ligase (NEB)	1 µl	400 U/µl stock is sufficient; add last
    BbsI	1 µl	Stored at -80°C
    H2O	Y µl
    In sum	20 µl

  Golden Gate Program:
  • 37°C , 10 min
  • 16°C , 10 min
  • Goto step 1, 9 times
  • 50°C , 5 min
  • 65°C , 20 min
  • 4°C , forever
• Transform 3 µl of each reaction to E. coli DH4α by heat shock(manufacturer's protocol) or electroporation(manufacturer's protocol)
• Plate 10% of recovery culture on selective plates with 10 µl of 0.5M IPTG and 40 µl of 20 mg/ml Bluo-gal (in DMSO).
• Pick white colonies to selective LB (for pTarget use streptomycine) and recover plasmid.

• Transformation of pCas9 in willed knock-out strain via electroporation:
  • Preheat SOC medium with 0.1% arabinose by 30°C
  • Thaw 50 µL electrocompetent E. coli cells (the knock-out/knock-in strain)on ice, dilute with icecold 50 µL glycerine (10%) if necessary
  • Add 1-5 µL plasmid to 50 µL electrocompetent cells
  • Store cells on ice for 1 minute
  • Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ω
  • Transfer transformation reaction to 950 µL prepared SOC-Medium and incubate 1 h at 30 °C
  • Plate on LB-Medium prepared with kanamycine and 0.1% arabinose
  • Incubate over night at 30 °C
• Create electrocompetent cells of the knock-out/knock-in strain carrying the pCas plasmid. ATTENTION: cultivation of the cells by 30°C in LB with 0,1% arabinose!
• PCR with the BioBrick BBa_K2082251:
  • Q5 master mix (25 µL):
    • 5 µL 5 x Q5 buffer
    • 0.5 µL 10 mM dNTPs
    • Up to 50 ng/µL-template (BBa_K2082251)
    • 0.1 µL Q5 DNA polymerase
    • 0.5 µl forward-primer:CC_FragAB_Reporter_fw
    • 0.5 µl reverse-primer:CC_FragAB_Reporter_rv
    • Ad 25 µL dH2O
  • Q5 standard protocol:
    • Initial denaturation: 98°C - 30 s
    • 30-35 cycles of:
      • Denaturation: 98 °C - 20 s
      • Annealing: 58 °C - 30 s
      • Elongation: 72 °C - 20 s/kb
    • Final elongation: 72 °C - 5 min
    • Storage: 4 °C
• Purification of the PCR product (manufacturer's protocol)
• Transformation of the purified PCR product and the guide-RNA-carrying plasmid pTarget in the pCas-carrying competent knock-out/knock-in strain of E. coli via electroporation
• Preheat SOC medium with 0.1% arabinose by 30°C
• Thaw 50 µL electrocompetent pCas-carrying E. coli cells (the knock-out/knock-in strain)on ice, dilute with icecold 50 µL glycerine (10%) if necessary
• Add 1-3 µL pTarget plasmid to 50 µL electrocompetent cells
• Add 2 µL purified PCR product to 50 µL electrocompetent cells
• Store cells on ice for 1 minute
• Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ω
• Transfer transformation reaction to 950 µL prepared SOC-Medium and incubate 1 h at 30 °C
• Plate first half of the transformed cells on LB-Medium prepared with kanamycine, streptomycine and 0.1% arabinose
• Plate second half of the transformed cells on LB-Medium prepared with kanamycine, streptomycine and 0.1% arabinosen + 20µg/ml ampicillin
• Incubate over night at 30 °C
• Pick colonies from the ampicillin-prepared LB plate and accomplish a colony PCR:
• 5 µL 5x GoTaq buffer (Promega)
• 1 µL MgCl₂ (25 mM stock)
• 0.5 µL dNTPs (10 mM each)
• 0.25 µL primer mix (prefix/suffix primers or sequencing primers) 100 mM
• 17.625 µL ddH₂O
• 0.125 µL GoTaq polymerase (Promega)
• 0.5 µL template
• PCR program
• Cell lysis and denaturation: 5 min, 95 °C
• 30 cycles
• Denaturation: 10 s, 95 °C
• Hybridisation: 30 s, annealing temperature
• Elongation: 60 s/kb of product, 72 °C
• Final elongation: 5 min, 72 °C
• Template alternatives
• Pick a colony with sterile tip, elute in 100 µL ddH₂O or buffer, store at 4 °C during PCR, plate if insert is of correct size
• Pick colony, streak at marked position on a new plate and solute remaining cells on the tip in the PCR tube with reaction mixture, cultivate if insert is of correct size
• Gel electrophoresis for control of fragment size
• Colonies with a fragment size of about 3,000 bp are the cells, with knock-out of the E. coli rpoZ gene and knock-in of the reporter BBa_K2082238

• Pipette 100 µl each of sample buffer, standard solutions and samples into clean test tubes.
• Add 5 ml 1X - staining solution
• Mix by inverting repeatedly
• Measure the OD 595 of the standard solutions and samples after 5 to 30 mins against the reference (sample buffer in 1X - staining dye).
• Plot and compare OD 595 of standard solutions to amount of protein u sed. The amount of protein in sample can be read on calibration

Plasmid preparation

• For a C-termninal fusion of your protein with the Intein Tag use the pTXB1 vektor, for a N-terminal fusion use the pTYB11 vektor.
• Cloning of the protein of interest directly before (pTXB1) or behind (pTYB11) the intein tag.
• Finished vektor with elektroporation or chemical transformation in E. coli expression strain ER2566 for cultivation

Cell growth

• Preculture: Inoculate some cells in 10 ml LB-medium (+ 200 µg/ml Ampicillin), growth by 37°C over nigth
• Main cultivation: Inoculate 250 ml LB (+ 200 µg/ml Ampicillin) with the preculture on an OD600 of 0.1. Growth by 37°C until it reaches an OD600 between 0.5 and 0.8. Addition of 0.5 mM IPTG and growth over night at 19°C.

Cell harvesting

• Transfer of all cells to a big centrifuge pot and centrifugation for 10-20 min at 4°C and 4,500 rpm.
• Resuspend the pellet in 20-30 ml Impact Lysis buffer and transfer it to BlueCaps.
• Cell disruption with the French Press (at least 2 times; max volume 35-40 ml) and keep the suspension on ice. Store 50 µl of the suspension at -20°C for SDS-PAGE.
• Centrifugation of the cell remains (4,500 rpm, 1 h, 4°C) and collect the supernatant in BlueCaps on ice. Store 50 µl of the suspension at -20°C for SDS-PAGE.

Preparation of the columns

• Seal the bottom of the column with Parafilm and pipet 5 ml water in it. Mark the fill level and let the water run out
• Fill the column with chitin beads up to the marked place and put a filter designator on the material.
• Equilibrate the column with 10 volumes of Impact column buffer (Low-Salt; only 2.92 g on 1 L instead of 58.44 g).

Loading of the column

• Give the clean supernatant of the cell harvesting on the column and let it flow through the column very slowly (flow through rate of a maximum of 0.5-1 ml/min). Store 50 µl of the flow through at -20°C for SDS-PAGE.

Washing of the column

• Wash the column with 10 volumes of Impact column buffer(High-Salt).

Induction of the cleavage

• Washing of the column with 3 volumes of Impact cleavage buffer. This step should not take more time than 30-60 min.
• Cleavage for 16-40 h at 23°C in the dark
• For better cleavage the amino acid which is fused with the intein tag should be Tyr, Phe, Gln, Asn, Thr, Lys, Ala, His, Leu or Met for C-terminal cleavage or Met, Ala, Gln, Gly, Leu, Asn, Trp, Phe or Tyr for N-terminal cleavage.

Elution

• Elution with 1-2 volumes of Impact column buffer (Low-Salt) in fresh BlueCap. Store 50 µl of the elution at -20°C for SDS-PAGE.
• Usage of a suitable protein filter to get a higher protein concentration. Centrifugation for 45 min at 4500-5000 rpm and 4°C until you have 250 µl left.
• Wash the protein solution 2-3 times with the Impact protein-wash buffer.
• Bradford-Assay to calculate the protein concentration.
• SDS-PAGE with 8 µg of the protein mixtures and 2 µg of the eluate
• The protein can be stored with 50% glycerin at -20°C.