Difference between revisions of "Team:Hong Kong HKU/Proof"

We used DNA to test our probe in the beginning due to two main considerations - price and stability. RNA is a lot more expensive than DNA strands, and at the same time, RNA degrades much more rapidly upon exposure to the environment in the presence of RNA nucleases.

We first used DNA inputs to prove our nanostructure being functional and to optimise our testing methods.

We took special precautions and methods when we did experiments for concept proof with RNA strands e.g. use of fume cupboards and DEPC-treated water.

PAGE for strand displacement

We replicated the same protocol with replacement of DNA input and mutant input by RNA versions. The sequences of the 2 sets of input and mutant input were the same.

Input	Sequence	Length (nt)
RNA Input	CAAUCAGGGUCUAACUCCACUGGGUGCCAU	30
Random RNA	CAGGCAGUAUCAUGCGACAUUGGGUGCAGC	30

12% acrylamide gels showing the strand displacement effect with the correct and random inputs - RNA (left) and DNA (right)

With the comparisons above, clearly strand displacement was successful with RNA inputs.

ABTS Assay for G-quadruplex formation

After showing that our DNA nanostructures can detect our target DNA, we went further to detect RNA. This test aimed to simulate the detection of serum miRNA, which has great potential in disease diagnosis as miRNA are promising disease biomarkers. The same sequence of RNA input as on the above was used in the assay.

First, we used our simplified DNA nanostructure (formed from the G-quadruplex side of O1 and O5 of the tetrahedron, which is the essential part of the 3D tetrahedral nanostructure) to detect RNA input. Equimolar (100nM final) DNA nanostructure and RNA input were added in the assay. The following bar chart shows the absorbance after the addition of different inputs.

Absorbance at 420nm after the addition of different inputs to the simplified DNA nanostructure (formed from O1's G-quadruplex side and O5 of the tetrahedron) which is termed as "beacon" in the above graph. The absorbance was taken 15 minutes after the addition of ABTS and H₂O₂. Error bars show standard deviation from triplicates.

Then, we repeated the experiment using our tetrahedral DNA nanostructure, which gave the following result.

Absorbance at 420nm after the addition of different inputs to the tetrahedral DNA nanostructure. The absorbance was taken 15 minutes after the addition of ABTS and H₂O₂. Error bars show standard deviation from triplicates.

From the above two graphs, it is clear that the addition of RNA input resulted in a higher absorbance than that without the addition of RNA input, whereas the addition of a random RNA sequence did not lead to a higher absorbance. Hence, we have successfully demonstrated that our design can distinguish the correct input (DNA or RNA) from random sequences.

Our DNA nanostructures can potentially be utilized as a simple diagnostic tool, where a higher absorbance in ABTS assay suggests the presence of our desired DNA or RNA target. We can easily expand the application to detect other DNA or RNA sequences by modifying the sequence of two strands at the detecting edge of the DNA nanostructure.