Difference between revisions of "Team:Hong Kong HKU/Experiments"
Louislo3412 (Talk | contribs) m |
|||
| Line 154: | Line 154: | ||
The mixture is incubated at room temperature for 30 minutes in a shaker. | The mixture is incubated at room temperature for 30 minutes in a shaker. | ||
100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL. | 100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H<sub>2</sub>O<sub>2</sub> (12mM final) are added to the mixture, making the final volume to be 150μL. | ||
| − | The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer. | + | The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.<br><br> |
</font></p> | </font></p> | ||
</div> | </div> | ||
| Line 160: | Line 160: | ||
</div> | </div> | ||
</div> | </div> | ||
| + | <p class="text-justify" align="left"><font size="3"> | ||
| + | Looking for more details? Click <a href="https://static.igem.org/mediawiki/2016/c/cf/T--Hong_Kong_HKU--DetailedProtocol.pdf">here</a> to explore!<br><br> | ||
| + | </font></p> | ||
</div> | </div> | ||
</div> | </div> | ||
Latest revision as of 02:29, 20 October 2016
Notebook
Protocol
One of the fundamental element in experiments is that it should be repeatable – and that's why we are providing all the protocols we used in our project here:
Equal amounts of the oligos are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM.
The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler.
The following table shows the sequence of our tetrahedral DNA nanostructure.
Cyan parts show the split G-quadruplex and the underlined sequences are the complementary sequence between O1 and O5.
The colour code used is the same as that in the paper fold of the structure (below the table).
| Oligo | Sequence (5' to 3') |
|---|---|
| O1(97nt) | CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCAC TGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAG TCGAGTGCTGCTGAGTA |
| O2(67nt) | CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGT GCGCTCATCGCACGATAGCAGACGACG |
| O3(84nt) | TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACAT AGACTGACACACGCATGACGCTATCGCAGCACGACTATCG CGCG |
| O4(84nt) | GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCA CAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTC ACAT |
| O5(30nt) | ATGGCACCCAGTGGAGTTAGACCCTGATTG |
The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μL, 10μM) are loaded.
For analysis by 1% agarose gel, 10μL samples (10μM) are loaded.
All the agarose gels are run at a constant voltage of 100V.
GelRed is used to prestained the gels.
For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker.
The mixture (5μL, 10μM) is then loaded to 12% polyacrylamide gel.
The PAGE is conducted at a constant voltage of 100V.
GelRed is used to prestained the gel.
ABTS assay is used to detect G-quadruplex.
DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 20μL buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5).
The mixture is incubated at room temperature for 30 minutes in a shaker.
100μL 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μL H2O2 (12mM final) are added to the mixture, making the final volume to be 150μL.
The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.
Looking for more details? Click here to explore!
