Revision as of 07:06, 15 October 2016

iGEM Oxford 2016 - Cure for Copper

Third Survey

Question 1
Question 2
Question 3
Question 4
Question 5
Results

Fourth Survey

Question 1
Question 2
Question 3
Question 4
Question 5
Question 6
Question 7
Results

QUESTIONNAIRES

Introduction

In order to provide a long-term treatment for Wilsons disease we realised we needed to design components of a bacterial system that could detect copper and produce a copper chelators to prevent its absorption by the body. These functions were tested separately to try to get a system able to operate on physiological copper concentrations.

Throughout all of our experiments we tried to think about whether the conditions the bacteria were growing in were likely to be realistic of the gut environment.

We spoke to patients with Wilsons’s disease and realised that, whilst many were comfortable with the idea of a synthetic biology treatment, the administration method for the treatment was one of their priorities. Many complained that their current treatments involved pills that were too large, had to be taken too frequently and had to be kept refrigerated making travelling difficult. From their feedback we investigated small alginate beads layered to survive the stomach in order to deliver our probiotic and hopefully found a large enough started population to have persistence in the gut.

Survey 1

In this survey we aimed to: investigate the public’s awareness of scientific issues that arise from our project to establish the areas we need to focus on in our outreach activities, assess the level of support our project might have if it were to be used as a treatment in the future and get an initial idea of whether people would prefer a single treatment or daily pill.

How old are you?

We found we had an uneven spread of age groups with a heavy bias towards under 21s. This is probably because we shared our survey shared via Facebook which has lots of younger users particularly among our friends who we got to fill it in. A a lot of our friends under 21 are those doing biology related degrees like us at university so they may not be representative of their age group as a whole. This may impact on results as different age groups learn different things at school according to age and people’s opinions on medical treatments may vary with age as issues become prominent. We decided to split results into under 21 and over 21 as the older groups are much smaller so there is little point in distinguishing between them.

Had you heard of genetic engineering before this survey?/h3>
We found that 90% people have heard of genetic engineering so don’t need to focus too much on public awareness of this Awareness greater among younger people than older people so if anything we should be focusing on people over 21 but 90% overall means we probably don’t need to do this.

Other Parts

One of our promoter parts (pCopA sfGFP with constitutive sfGFP) was sequenced four times from separate PCR and transformation attempts and had the same two point mutations on each attempt. We attributed this to a synthesis issue and this part was abandoned. However we wanted to get a similar sequence with the same design as this part so we amplified the promoter system and constitutive CueR only from our part: pCopA MymT sfGFP with constitutative CueR and then ligated the resulting sequence with prefix and suffix into the pSB1C3 shipping vector.

We also received from Tom Folliard, a PhD student in our lab, a plasmid containing a copper biosensor (pCusC mKate) he had done a small amount of work on previously. We characterised this part further and attempted to make it biobrick compatible. As the part had an illegal SpeI restriction site in the ribosome-binding site we amplified the promoter region only so we could deposit this in the registry. We also wanted to deposit the entire testing component complete with promoter, ribosome binding site and RFP. After attempts at site directed mutagenesis failed we ordered this part without this site from IDT.

Promoter Characterisation

Experimental Design

We decided that our copper chelating bacteria would require a promoter system able to detect dietary copper rather than just constitutive expression. This has three main advantages:

If the bacteria are made to produce the chelator constantly, even when it is not required, then this will increase use of cell resources such as amino acids. This increases selection pressure for the gene to mutate out and decreases the likelihood of our bacteria strain being able to successfully compete with other gut bacteria.

If the copper chelator is expressed at all times then the rate of copper chelation is essentially uncontrolled and only a function of the number of bacteria present which could could feasibly vary slightly due to short-term factors such as food intake or illness. This unpredictable behaviour would be difficult to reconcile with other treatments.

Constitutive chelator expression that is too low for a particular patent at a particular time will not treat their symptoms effectively. If the chelator expression is too high however they may experience copper deficiency.

We found two different copper sensitive promoter systems: CueR-linked and CusS/CusR-linked (see our parts page) and investigated rearranging the components to form feedback systems in order to improve sensitivity over the physiological range of copper concentrations.

We aimed to characterise all of our promoters using three different methods:

Plate reader

Flow cytometry

Microscopy

The plate reader experiments were preformed to study how the expression of the fluorescent protein changes with copper concentration and changes over time. This data was used to parameter fit the models of each promoter system.

Flow cytometry was performed to confirm the results of the plate reader and to provide a measure of the variance in expression within each population at different copper concentrations.

Microscopy was performed to qualitatively confirm the results of the previuos two methods and to study the cellular localisation of the fluorescent proteins.

Further details of each of these can be found on our experiments page and full protocols on our protocols page.

Results

For all of our promoter systems the results of all three experimental methods were broadly consistent.

We investigated three designs of a promoter system based upon the CueR-linked system:

One (pCopA sfGFP) was the simplest but only responsive to copper at high concentrations. This promoter alone was therefore not considered suitable for our system.

pCopA sfGFP

To investigate whether this insensitivity was due to there being only a single copy of the CueR gene from the cell genome compared with the 500+ copies of pCopA on the high copy plasmid we wanted to test a version of the part with constitutive CueR. We based this upon a part in the registry already (see our parts page) but never managed to clone it successfully possibly due to a synthesis issue. However we did produce two parts (Numbers) with our chelators in front of the sfGFP. These are expected to operate much like the part without the chelator if we consider the amount of copper bound by the chelator to be negligible. These both appeared more copper responsive than the pCopA promoter alone although the much large TAT Csp1 appeared to have expression issues at higher copper concentrations forming inclusion bodies seen in the microscopy images:

pCopA MymT sfGFP with constitutive CueR

pCopA TAT Csp1 sfGFP with constitutive CueR

We wanted to experiment with the CueR-system further by adding in a feedback loop. CueR has an interesting mechanism of action meaning that it can operate both as an activator and a repressor depending on the copper concentration. We designed a part where CueR is expressed from pCopA from a plasmid in front of sfGFP hoping that this would act as a positive feedback system increasing the sensitivity of the part. Instead it appears to act as negative feedback system dampening the response to copper compared to the part with constitutive expression. This also seems to have reduced the variation between cells as shown by the flow cytometer data. Under some circumstances this could be a useful feature being able to keep the chelator concentration more similar and predictable over a wider concentration range but this part and behaviour was not deemed to be useful over the physiological copper concentrations we were interested in.

pCopA CueR sfGFP/ Feedback pCopA sfGFP

We also received a part containing a copper biosensor: pCusC mKate, from Tom Folliard, a PhD student in our lab. Whilst he had some preliminary late reader data we characterised it further. While not directly comparable to our other parts due to the different fluorescent protein this promoter turned out to be much more sensitive and responsive than any of the CueR systems:

pCusC mKate

Copper Chelation

We attempted to show that our two copper chelating proteins chelated copper when expressed from E. coli. With limited time and budget we tried to develop a absorbance assay for copper using the reagent BCS. (1)(2) We used this to assay to test both live cells and purified proteins for the ability to reduce free copper concentration. Unfortunately the assay was either too insensitive to show an effect or our chelators were not operating as intended. With more time we hoped to develop the assay further.

We also came across a paper by Hötzer et al (3) that detailed how it might be possible to use the fluorescence lifetime of a His tagged GFP as a copper assay. Lacking access to a FLIM machine we contacted Cardiff iGEM who were kind enough to run a few of our samples in their FLIM machine.

BCS Absorbance Assay

Description of how the assay works.

Assay in vivo

Description of how we tested in vivo.

Protein Purification

How Andreas purified shit

in vitro

Description of how we tested in vitro.

Fluorescence Lifetime Imaging

Text about the Cardiff Collaboration. with lots of thanks to go around.

References

(1) Poillon W. and Dawson C. (1963)"ON THE NATURE OF COPPER IN ASCORBATE OXIDASE I. THE VALENCE STATE OF COPPER IN THE DENATURED AND NATIVE ENZYME" Biochim Biophys Acta. 1963 Sep 3;77:27-36

(2) Rapisarda V., Volentini S., Ricardo N., Massa E. (2002) "Quenching of bathocuproine disulfonate fluorescence by Cu(I) as a basis for copper quantification" Analytical Biochemistry, 307(1)m pp. 105-109. doi: 10.1016/S0003-2697(02)00031-3

(3) Hötzer B., Ivanov R., Altmeier S., Kappl R., Jung G., (2011) "Determination of copper(II) ion concentration by lifetime measurements of green fluorescent protein." Journal of Fluorescence, 21(6), pp. 2143-2153. doi: 10.1007/s10895-011-0916-1

Alginate Bead Preparation

Based upon patient feedback into delivery systems we decided to investigate the feasibility of using alginate beads to encase our bacteria and successfully deliver them to the intestine, while maintaining their integrity in the stomach. As quantitative measure of bead stability we used the dye Crystal Violet which we could measure by it absorbance at 495nm.

Alginate only

Our first experiment was to prepare a 2% (weight/volume) sodium alginate solution, which was done dissolving 2g of alginate in 100ml of warm MilliQ. We then added 2ml of the dye. This solution was then dropped with a pipette into a solution of 0.1mM CaCl₂ that solidifies and hardens the alginate.

We found during their first 30 minutes in the CaCl₂ solution (the “stabilisation phase”) dye did leak from the beads. We then transferred the beads into a fresh CaCl₂ solution and found the beads no longer leaked dye. Hence, the beads had stabilised.

The beads before hardening showing leakage of the dye:

The beads after hardening in one calcium solution for 30mins then transferred to another for one hour with no signs of leakage:

To investigate the stability of our beads within the body we decided to place the alginate-dye beads into stomach and intestine simulation solutions and measured the concentration of dye released into each solution using absorbance at 595nm.

We stimulated the conditions of the stomach by making up 0.2% (w/v) NaCl solution made up to pH 2.0 with 1M HCl.

We simulated the conditions of the intestine by making 0.68% (w/v) monobasic potassium phosphate solution, made up to pH 7.2 with 1M NaOH.

The 2 solutions are placed into a incubator shaking at 37°C for 90 minutes. Every 10 minutes 100μl of solution is removed and placed into 1 well of a 96 well plate. Measure absorption of each well once 90 minutes is complete.

GRAPH HERE WHEN DONE

The results suggested alginate beads would not be able to carry out bacteria successfully into the intestine, as the stomach acid would disintegrate the beads and hence kill our bacteria. We then decided to re-design the beads.

With Chitosan

Upon analysis of our results we decided to improve the stability of the beads using repeating layers of chitosan and alginate. This was suggested by our research into probiotic delivery. The layering was done by preparing the beads as before then after their 30 minutes hardening, filtering them and alternatively dipping into 0.4% (w/v) chitosan solution (in 0.1M acetic acid adjusted to pH 6.0 with 1M NaOH, 10ml) for 10 mins and 0.04% (w/v) alginate solution (10ml) for 10 min.

10ml of these beads were placed in flasks of 100ml stomach simulate and intestinal simulate solutions and incubated in a 37°C shaker for 90 minutes. Every 10 minutes, 100μl samples were taken and after the whole 90 minutes the absorbance of each of the samples was measure at 595nm with a plate reader.

GRAPH HERE WHEN DONE

We found that our the absorbance of the stomach solution did not increase over time indicating that layering the alginate with chitosan allowed the beads to maintain their structural integrity and retain the dye. Conversely, in the small intestine, the more alkaline pH causes the layered coating to degrade, steadily releasing dye into solution.

This suggests that this method would be a good way of delivering our bacteria to the small intestine, as our probiotic would be released along the small intestine.

If we had more time we would test this system again by encapsulating bacteria that constitutively express GFP into the original alginate matrix and measure the fluorescence at different time points. At the end of the experiment, test the viability of the bacteria by taking an aliquot of the small intestine solution and adding it to LB broth and leaving to incubate overnight. Bacterial growth would show the bacteria had survived the solution.

References

Cook, M.T., Tzortzis, G., Khutoryanskiy, V.V. and Charalampopoulos, D. (2013) ‘Layer-by-layer coating of alginate matrices with chitosan–alginate for the improved survival and targeted delivery of probiotic bacteria after oral administration’, J. Mater. Chem. B, 1(1), pp. 52–60. doi: 10.1039/c2tb00126h.

Chávarri, M., Marañón, I., Ares, R., Ibáñez, F.C., Marzo, F. and Villarán, M. del C. (2010) ‘Microencapsulation of a probiotic and prebiotic in alginate-chitosan capsules improves survival in simulated gastro-intestinal conditions’, International Journal of Food Microbiology, 142(1-2), pp. 185–189. doi: 10.1016/j.ijfoodmicro.2010.06.022.

Krasaekoopt, W., Bhandari, B. and Deeth, H. (2004) ‘The influence of coating materials on some properties of alginate beads and survivability of microencapsulated probiotic bacteria’, International Dairy Journal, 14(8), pp. 737–743. doi: 10.1016/j.idairyj.2004.01.004.

Conclusions

How did we do in all three areas and what experiments would we do if we had more time, energy and money

@@ Line 41: / Line 41: @@
              </li>
              <li>
-                 <a href="#2">Cloning</a>
+                 <a href="#2">First Survey</a>
                           <ul class="nav nav-stacked">
                           <li><a href="#Standard">Standard</a></li>
@@ Line 49: / Line 49: @@
              </li>
              <li>
-                 <a href="#3">Promoter Characterisation</a>
+                 <a href="#3">Second Survey</a>
                           <ul class="nav nav-stacked">
-                          <li><a href="#sub1">Experimental design</a></li>
+                          <li><a href="#sub1">Question 1</a></li>
-                          <li><a href="#sub2">Results</a>
+                          <li><a href="#sub2">Question 2</a>
-                               <ul class="nav nav-stacked">
+                         <li><a href="#sub3">Question 3</a>
-                                 <li><a href="#subA">pCopA sfGFP</a></li>
+                         <li><a href="#sub4">Question 4</a>
-                                 <li><a href="#subB">pCopA sfGFP- const. CueR</a></li>
+                         <li><a href="#sub5">Question 5</a>
-                                 <li><a href="#subC">pCopA CueR sfGFP</a></li>
+                         <li><a href="#sub6">Question 6</a>
-                                 <li><a href="#subD">pCusC RFP</a></li>
+                         <li><a href="#sub7">Results</a></li>
                                 </ul>
                            </li>
@@ Line 63: / Line 64: @@
              </li>
              <li>
-                <a href="#4">Copper Chelation</a>
+                  <a href="#4">Third Survey</a>
-                               <ul class="nav nav-stacked">
+                         <ul class="nav nav-stacked">
-                                 <li><a href="#BCS">BCS Absorbance Assay</a>
+                         <li><a href="#sub1">Question 1</a></li>
-                                 <ul class="nav nav-stacked">
+                         <li><a href="#sub2">Question 2</a>
-                                  <li><a href="#in vivo">Assay with live cells</a></li>
+                         <li><a href="#sub3">Question 3</a>
-                                  <li><a href="#purification">Protein Purification</a></li>
+                         <li><a href="#sub4">Question 4</a>
-                                  <li><a href="#in vitro">Assay with purified proteins</a></li>
+                         <li><a href="#sub5">Question 5</a>
-                                 </ul>
+                         <li><a href="#sub7">Results</a></li>                                  </ul>
-                                 </li>
-                                 <li><a href="#FLIM">FLIM</a></li>
-                               </ul>
              </li>
              <li>
-                <a href="#5">Alginate Bead Preparation</a>
+                  <a href="#3">Fourth Survey</a>
                           <ul class="nav nav-stacked">
-                          <li><a href="#alginate">Alginate only</a></li>
+                          <li><a href="#sub1">Question 1</a></li>
-                          <li><a href="#Chitosan">with Chitosan</a></li>
+                          <li><a href="#sub2">Question 2</a>
+                         <li><a href="#sub3">Question 3</a>
+                         <li><a href="#sub4">Question 4</a>
+                         <li><a href="#sub5">Question 5</a>
+                         <li><a href="#sub6">Question 6</a>
+                         <li><a href="#sub7">Question 7</a>
+                         <li><a href="#sub8">Results</a></li>
                           </ul>
-             </li>
-            <li>
-                <a href="#6">Conclusions</a>
-            </li>
-        </ul>
-    </nav>
 <div class="col-md-9 content-right" style="background-color: #fff;">
-<h1>OVERVIEW</h1>
+<h1>QUESTIONNAIRES</h1>
 <section id="1">
@@ Line 105: / Line 104: @@
 <section id="2">
-<h2>Cloning</h2>
+<h2>Survey 1</h2>
-<section id="Standard">
-<h3>Standard Cloning</h3>
-<p>
- All of our original part sequences were synthesised by IDT between the <a data-toggle="popover1" data-trigger="hover" title="Biobrick prefixes" data-content="GAATTCGCGGCCGCTTCTAGAG or GAATTCGCGGCCGCTTCTAG if the part begins with ATG" placement: "top">appropriate Biobrick prefix</a> containing <a data-toggle="popover1" data-trigger="hover" title="EcoRI" data-content="G/AATTC" placement: "top">EcoRI</a>/<a data-toggle="popover1" data-trigger="hover" title="XbaI" data-content="T/CTAGA" placement: "top">XbaI</a> restriction sites and the universal biobrick suffix sequence containing <a data-toggle="popover1" data-trigger="hover" title="SpeI" data-content="A/CTAGT" placement: "top">SpeI</a>/<a data-toggle="popover1" data-trigger="hover" title="PstI" data-content="CTGCA/G" placement: "top">PstI</a> restriction sites. Short pre-preffix and post-suffix sequences were included for the binding of our amplification primers. All our chelators were synthesized with a C terminal sequence encoding a hexahistidine tag.
 </p>
+In this survey we aimed to: investigate the public’s awareness of scientific issues that arise from our project to establish the areas we need to focus on in our outreach activities,
+assess the level of support our project might have if it were to be used as a treatment in the future and get an initial idea of whether people would prefer a single treatment or daily pill.
 <p>
- The sequences were amplified using PCR and ligated into the <a href="http://parts.igem.org/Part:pSB1C3">pSB1C3</a> BioBrick shipping vector backbone before being cloned into <i>E. coli </i> DH5α strain. After growth on a plate containing <a data-toggle="popover1" data-trigger="hover" title="Chloramphenicol" data-content="An antibiotic that operates by blocking peptide chain elongation. Resistance is provided by the chloramphenicol acetyltransferase encoded by the shipping plasmid" placement: "top">chloramphenicol</a>, colonies were then picked and grown overnight in 5ml of LB and plasmid DNA extracted via miniprep. These plasmids were then digested and those with the correct band size sent off for sequencing.
+<section id="Question 1">
+<h3>How old are you?</h3>
+<p>
+We found we had an uneven spread of age groups with a heavy bias towards under 21s. This is probably because we shared our survey shared via Facebook which has lots of younger users particularly among our friends who we got to fill it in. A a lot of our friends under 21 are those doing biology related degrees like us at university so they may not be representative of their age group as a whole. This may impact on results as different age groups learn different things at school according to age and people’s opinions on medical treatments may vary with age as issues become prominent. We decided to split results into under 21 and over 21 as the older groups are much smaller so there is little point in distinguishing between them.
 </p>
-<p>
- Correctly sequenced parts were then kept for testing and deposition in the registry. All or promoter parts were tested in the shipping vector after being cloned into the <i> E. coli</i> K-12 MG1655 strain.
   </p>
 </section>
-<section id="Chelators">
+<section id="Question 2">
-<h3>Chelators</h3>
+<h3>Had you heard of genetic engineering before this survey?/h3>
 <p>
-  Our copper chelator parts lacked a promoter so had to be ligated into the <a data-toggle="popover1" data-trigger="hover" title="Arabinose" data-content="a five-carbon sugar" placement: "top">arabinose</a>-inducible pBAD His B commercial expression plasmid for characterization. This was done by adding a <a data-toggle="popover1" data-trigger="hover" title="BspHI" data-content="T/CATGA" placement: "top">BspHI</a> restriction site (an <a data-toggle="popover1" data-trigger="hover" title="Isocaudamer" data-content="Restriction ezymes with different recognition sequences but compatible sticky ends e.g. SpeI and XbaI" placement: "top">isocaudamer</a> of <a data-toggle="popover1" data-trigger="hover" title="NcoI" data-content="C/CATGG" placement: "top">NcoI</a>) into the part at the initiator methionine using PCR. The pBAD vector was digested with <a data-toggle="popover1" data-trigger="hover" title="NcoI" data-content="C/CATGG" placement: "top">NcoI</a> and <a data-toggle="popover1" data-trigger="hover" title="PstI" data-content="CTGCA/G" placement: "top">PstI</a> and the insert with <a data-toggle="popover1" data-trigger="hover" title="BspHI" data-content="T/CATGA" placement: "top">BspHI</a> and <a data-toggle="popover1" data-trigger="hover" title="PstI" data-content="CTGCA/G" placement: "top">PstI</a>. Once ligated these were then transformed into <i>E. coli </i> DH5α strain, extracted sequenced and correct parts were then transformed into <i> E. coli</i> K-12 MG1655. The pBAD expression vector contains a copy of β-lactamase gene allowing cells with the plasmid to have <a data-toggle="popover1" data-trigger="hover" title="Ampicillin" data-content="An β-lactam antibiotic that irreversibly inhibits the transpeptidase enzyme used to make bacterial cell walls" placement: "top">ampicillin</a> resistance. Consequently ampicillin was used for all transformations using these parts.
+  We found that 90% people have heard of genetic engineering so don’t need to focus too much on public awareness of this
+Awareness greater among younger people than older people so if anything we should be focusing on people over 21 but 90% overall means we probably don’t need to do this.
 </p>
 </section>

Difference between revisions of "Team:Oxford/Questionnaires"

Revision as of 07:06, 15 October 2016