Difference between revisions of "Team:Hong Kong HKU/Design"

(Update information)
(Update)
Line 22: Line 22:
 
background-attachment:fixed;}
 
background-attachment:fixed;}
 
.container
 
.container
−
{background-color: rgba(255,255,255,0.4);
+
{background-color: rgba(255,255,255,0.6);
 
padding-top:80px;}
 
padding-top:80px;}
 
p {font-size: 16px;}
 
p {font-size: 16px;}
Line 67: Line 67:
 
       <div id="Design" class="tab-pane fade in active">
 
       <div id="Design" class="tab-pane fade in active">
 
         <h3>Design</h3>
 
         <h3>Design</h3>
−
     <p class="text-justify"><font size="3">
+
        <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/a/af/T--Hong_Kong_HKU--StrandDisplacement.jpg" alt="">
−
         The tetrahedron consists of 5 oligos lengthing from 30 to 97 nucleotides.  
+
     <p class="text-justify" align="left"><font size="3">
−
         The tetrahedron is composed of 362 nucleotides in total.  
+
         Our design is a tetrahedral nanostructure for diagnostic purposes.
−
         The formation of the structures is allowed by a standard procedure of heating it up followed by step-wise cooling. <br>
+
        It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides.  
−
        The detailed protocol can be found <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Experiments">here</a>.<br>
+
         The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC.  
−
         From the diagram above, several combinations of oligos are expected to anneal to form dimers, trimers and quadruplexes. <br>
+
         The details of the DNA nanostructure assembly can be found in <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Experiments">here</a>.  
−
        The results from PAGE can be found <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">here</a>.<br>
+
         The oligo sequences are shown below:<br>
 
         </font></p>
 
         </font></p>
 +
        <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/9/91/T--Hong_Kong_HKU--TetraDesign1.png" alt="">
 
         <table class="table">
 
         <table class="table">
 
         <thead>
 
         <thead>
Line 85: Line 86:
 
             <tbody>
 
             <tbody>
 
             <tr>
 
             <tr>
−
                 <td style="text-align:center">O1</td>
+
                 <td style="text-align:center">Oligo 1</td>
−
                     <td>CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA</td>
+
                     <td>CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT<br>CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA</td>
 
                     <td style="text-align:center">97</td>
 
                     <td style="text-align:center">97</td>
 
                 </tr>
 
                 </tr>
 
             <tr>
 
             <tr>
−
                 <td style="text-align:center">O2</td>
+
                 <td style="text-align:center">Oligo 2</td>
−
                     <td>CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCACGATAGCAGACGACG</td>
+
                     <td>CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC<br>GATAGCAGACGACG</td>
 
                     <td style="text-align:center">67</td>
 
                     <td style="text-align:center">67</td>
 
                 </tr>
 
                 </tr>
 
             <tr>
 
             <tr>
−
                 <td style="text-align:center">O3</td>
+
                 <td style="text-align:center">Oligo 3</td>
−
                     <td>TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACGCATGACGCTATCGCAGCACGACTATCGCGCG</td>
+
                     <td>TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG<br>CATGACGCTATCGCAGCACGACTATCGCGCG</td>
 
                     <td style="text-align:center">84</td>
 
                     <td style="text-align:center">84</td>
 
                 </tr>
 
                 </tr>
 
             <tr>
 
             <tr>
−
                 <td style="text-align:center">O4</td>
+
                 <td style="text-align:center">Oligo 4</td>
−
                     <td>GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTCACAT</td>
+
                     <td>GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC<br>GTCATGCGTGTGTCAGAGTGCACTGTCACAT</td>
 
                     <td style="text-align:center">84</td>
 
                     <td style="text-align:center">84</td>
 
                 </tr>
 
                 </tr>
 
             <tr>
 
             <tr>
−
                 <td style="text-align:center">O5</td>
+
                 <td style="text-align:center">Oligo 5</td>
 
                     <td>ATGGCACCCAGTGGAGTTAGACCCTGATTG</td>
 
                     <td>ATGGCACCCAGTGGAGTTAGACCCTGATTG</td>
 
                     <td style="text-align:center">30</td>
 
                     <td style="text-align:center">30</td>
Line 112: Line 113:
 
         </table>
 
         </table>
 
         <br>
 
         <br>
 +
        <p class="text-justify" align="left"><font size="3">
 +
        To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease.
 +
        The miRNA is expected to displace O5 from the tetrahedral structure.
 +
        With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced.
 +
        Oligo 1 would then be able to fold into a G-quadruplex structure,
 +
        which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color.
 +
        The sequence of the miRNA for Huntington disease used for testing is shown below:
 +
        </font></p>
 
         <table class="table">
 
         <table class="table">
 
         <thead>
 
         <thead>
Line 133: Line 142:
 
             </tbody>
 
             </tbody>
 
         </table>
 
         </table>
−
        <div id="carousel1" class="carousel slide" data-ride="carousel">
 
−
          <ol class="carousel-indicators">
 
−
            <li data-target="#carousel1" data-slide-to="0" class="active"></li>
 
−
            <li data-target="#carousel1" data-slide-to="1"></li>
 
−
            <li data-target="#carousel1" data-slide-to="2"></li>
 
−
          </ol>
 
−
          <div class="carousel-inner" role="listbox">
 
−
            <div class="item active"><img src="https://static.igem.org/mediawiki/2016/d/d7/T--Hong_Kong_HKU--TetraDesign-Frontview.jpg" alt="" class="center-block">
 
−
              <div class="carousel-caption">
 
−
                <p>Front view</p>
 
−
              </div>
 
−
            </div>
 
−
            <div class="item"><img src="https://static.igem.org/mediawiki/2016/8/8d/T--Hong_Kong_HKU--TetraDesign-Sideview.jpg" alt="" class="center-block">
 
−
              <div class="carousel-caption">
 
−
                <p>Side view</p>
 
−
              </div>
 
−
            </div>
 
−
            <div class="item"><img src="https://static.igem.org/mediawiki/2016/7/78/T--Hong_Kong_HKU--TetraDesign-Topview.jpg" alt="" class="center-block">
 
−
              <div class="carousel-caption">
 
−
                <p>Top view</p>
 
−
              </div>
 
−
            </div>
 
−
            <div class="item"><img src="https://static.igem.org/mediawiki/2016/f/fc/T--Hong_Kong_HKU--TetraDesign-Perspectiveview.jpg" alt="" class="center-block">
 
−
              <div class="carousel-caption">
 
−
                <p>Perspective view</p>
 
−
              </div>
 
−
            </div>
 
−
          </div>
 
−
          <a class="left carousel-control" href="#carousel1" role="button" data-slide="prev"><span class="glyphicon glyphicon-chevron-left" aria-hidden="true"></span><span class="sr-only">Previous</span></a><a class="right carousel-control" href="#carousel1" role="button" data-slide="next"><span class="glyphicon glyphicon-chevron-right" aria-hidden="true"></span><span class="sr-only">Next</span></a></div>
 
−
  <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/9/91/T--Hong_Kong_HKU--TetraDesign1.png" alt="">
 
 
           <p class="text-justify"><font size="3">
 
           <p class="text-justify"><font size="3">
−
           The design employs the strand displacement mechanism, which is commonly employed in DNA nanostructure designs.
+
           For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases.
−
          In our design, we include this as a major part and we thought out and performed various ways to detect such reaction. <br>
+
−
          During the reaction, two strands with partly or fully complementary sequences hybridize each other, displacing one or more pre-hybridized strands.
+
−
          This process is initiated at a single-stranded site called a  "toehold".
+
−
          Since RNA is a lot more unstable than DNA, we first test our designs with DNA-version of the input strand, instead of RNA. <br>
+
−
          You are encouraged to check out more results <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">here</a> for the examination of properties of this nanostructure.
+
 
         </font></p>
 
         </font></p>
−
          <img class="img-responsive center-block" width="600px" height="auto" src="https://static.igem.org/mediawiki/2016/a/af/T--Hong_Kong_HKU--StrandDisplacement.jpg" alt="">
 
 
       </div>
 
       </div>
 
     </div>
 
     </div>

Revision as of 06:04, 19 October 2016

Project

Design

Our design is a tetrahedral nanostructure for diagnostic purposes. It consists of five oligonucleotides (oligos, O1 to O5) with lengths ranging from 30 to 97 nucleotides. The oligos are assembled by heating at 95ºC for 5 minutes and then cooled to 25ºC. The details of the DNA nanostructure assembly can be found in here. The oligo sequences are shown below:

Tetra forming Oligo Sequence Size (nucleotide)
Oligo 1 CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGT
CGAGCTCACGTGCGTCACGCGCGATAGTCGAGTGCTGCTGAGTA		 97
Oligo 2 CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCAC
GATAGCAGACGACG		 67
Oligo 3 TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACG
CATGACGCTATCGCAGCACGACTATCGCGCG		 84
Oligo 4 GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGC
GTCATGCGTGTGTCAGAGTGCACTGTCACAT		 84
Oligo 5 ATGGCACCCAGTGGAGTTAGACCCTGATTG 30

To test our design, we used a miRNA sequence found in patients who have high risks of acquiring Huntington disease. The miRNA is expected to displace O5 from the tetrahedral structure. With Oligo 5 displaced, steric hindrance within the tetrahedron would hence be reduced. Oligo 1 would then be able to fold into a G-quadruplex structure, which serves as a DNAzyme to catalyze the reaction between hemin, ABTS and hydrogen peroxide, which gives a green color. The sequence of the miRNA for Huntington disease used for testing is shown below:

Input Oligo Sequence Size (nucleotide)
Input CAATCAGGGTCTAACTCCACTGGGTGCCAT 30
RNA Input CAAUCAGGGUCUAACUCCACUGGGUGCCAU 30

For future development as a diagnostic tool with broader applications, part of the DNA sequence can be altered for the detection of other miRNAs for various diseases.


Copyright © 2016 HKU iGEM. All rights reserved.