Team:Tokyo Tech/AHL Assay/Rhl System Assay

3-2-3 Rhl system Assay

1. Introduction

　As shown in the previous sections, Prhl activity was too weak compared to Plux to operate the final genetic circuits. Similarly, simulation results suggested that the circuits did not work as expected due to the same reason (see the Model page). We expected that this situation can be circumvented by using the previously improved Prhl (BBa_K1529310, BBa_K1529300) that was established by iGEM 2014 Tokyo_Tech. However, these Prhl promoters were also found to be inappropriate for two reasons (see the Discussion). Therefore, we improved the Prhl Promoter by our own team and succeeded to obtain novel and appropriate Prhl (Noticeable Mutant) (BBa_K1949060), hereafter referred to as Prhl(NM).

2. Summary of the Experiment

Our purpose is to create strong Prhl for our final genetic circuits.
　This experiment consists of the three parts below.
I. Improved Prhl by iGEM 2014 Tokyo_Tech and characterization of rhlR
II. Improvement of the native Prhl
III. Comparison of the improved Prhl by iGEM 2014 Tokyo_Tech to our original improved Prhl

3. Results

I. Improved Prhl by iGEM 2014 Tokyo_Tech and characterize RhlR assay
We found that Prhl(RL) (BBa_K1529300) activity was weak and the expression level depended on ssrA tag (Fig.3-2-3-3-1); ssrA-tagged proteins are prone to be degraded by cellular proteases. Prhl(LR) (BBa_K1529310) activity was strong but unexpectedly reacted with C12 (crosstalk) (Fig.3-2-2-3-4).



Fig. 3-2-2-2 RFU of GFP / Turbidity of Only Assay


Fig. 3-2-3-3-1 Comparison of the Past improved Prhl and RhlR


Fig. 3-2-3-3-2 Comparison of the Past improved Prhl and RhlR adding high concentration C4

The colonies of transformants with a rhlR (BBa_C0171) plasmid looked rough and the growth rate was low(Fig.3-2-3-3-3-left), while the colonies of transformants with a rhlR-ssrA (BBa_C0071) plasmid looked smooth and the growth rate was normal(Fig.3-2-3-3-3-right). However, the reason for this result is unclear.



Fig. 3-2-3-3-3 The colonies of transformants with a rhlR (left) or a rhlR-ssrA right)


II. Improvement the native Prhl
By introducing a single point mutation into native Prhl (BBa_R0071) by PCR, we obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter activity was stronger than native Prhl(Fig.3-2-2-3-4).


Fig. 3-2-3-3-4 RFU of GFP / turbidity of imoroved Prhl mutants

The sequences of these tow chosen mutants are shown in below. The small characters indicate the scar sequence and a single point mutation is colored with red.

Native Prhl (BBa_R0071)
TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTAAAAAGTGTTC tactagagAAAGAGGAGAAA

Prhl(NM) (BBa_K1949060)
TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTATAAAGTGTTC tactagagAAAGAGGAGAAA

Prhl(M)
TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTATAAAGTGTTC tactagtaAAAGAGGAGAAA

III. Comparison the improved Prhl by iGEM 2014 Tokyo_Tech to our original improved Prhl
Prhl(NM) was chosen from the many Prhl mutants, and by comparing Prhl(NM) to Prhl(LR), we obtained the result below (Fig.3-2-2-3-4). The reaction activity of Prhl(NM) to C4 was stronger than that of Prhl(LR), and Prhl(NM) did not react with C12 at all.


Fig. 3-2-3-3-5 Comparison of Prhl(NM) to Prhl(LR)

4. Discussion

Judging from the result of the experiment I, we found that Prhl(RL) activity was unexpectedly weak and enough expression could not be obtained without high C4 concentration which is designed by iGEM 2014 Tokyo_Tech.
The result that RhlR in the absence of C4 represses Prhl and the repression is contradicted when RhlR binds C4(1), RhlR without ssrA tag repressed so strong that gfp could not express very much under the low C4 concentration (Fig.3-2-3-3-1). On the other hand, under the high C4 concentration, a lot of RhlR binded C4. Then the repression was contradicted and gfp expressed greatly(Fig.3-2-3-3-2). RhlR with ssrA tag tended to degrade and the RhlR concentration in a cell was low. And that the repression by RhlR was not strong and gfp could express. RhlR without ssrA tag could repress the growth rate of E. coli but the reason for this is unclear.
Prhl activity became stronger when the sequence of -10 region was changed from “TAAAAA” to "TATAAA", which is known as a part of the strongest promoter sequence in E. coli. Prhl(M) had accidental two mutations in the scar sequence and it is not suitable for a new part of BioBrick.
We think that the combination of the AHL regulators and the corresponding promoters also could control the expression level of the target gene. In our project, the combination of rhlR with ssrA tag and Prhl(LR) might work well in our final genetic circuits. However, Prhl(LR) has lux box, and thus, the promoter also reacts with C12 (crosstalk) unintentionally. In our final circuits, we have to use C12 for Plux activation, and thus, Prhl(LR) does not suit for our final circuits. Then, we introduced a single point mutation into native Prhl (BBa_R0071), we obtained the Prhl(NM) of which activity was stronger than Prhl(LR). Comparing the Prhl(NM) to Prhl(LR), Prhl(NM) did not show crosstalking with C12 and the SN ratio of Prhl(NM) was higher than that of Prhl(LR). The SN ratio Prhl(LR) to C4 was small, because leaky expression from Prhl(LR) was high.
As a conclusion, the combination of rhlR with ssrA tag and Prhl(NM) is best for our final genetic circuits.

5. Materials and Methods

5-1. Construction

-Strain
All the plasmids were prepared in XL1-Blue strain.

-Plasmids
I. Improved Prhl by iGEM 2014 Tokyo_Tech and rhlR assay
A. Pcon-rhlR-ssrA(BBa_C0071) (pSB6A1), Prhl(LR)(BBa_K1529310)-gfp (pSB3K3) (Fig. 3-2-3-5-1)

B. Pcon-rhlR(BBa_C0171) (pSB6A1), Prhl(LR)-gfp (pSB3K3) (Fig. 3-2-3-5-2)
C. Pcon-rhlR-ssrA (pSB6A1), Prhl(RL)(BBa_K1529300)-gfp (pSB3K3) (Fig. 3-2-3-5-3)
D. Pcon-rhlR (pSB6A1), Prhl(RL)-gfp (pSB3K3) (Fig. 3-2-3-5-4)
E. Pcon-rhlR-ssrA (pSB6A1), Pcon-gfp (pSB3K3) …Positive control (Fig. 3-2-3-5-5)
F. pSB6A1, pSB3K3 …Nagative control (Fig. 3-2-3-5-6)

II. Improvment the native Prhl
A. Prhl(BBa_R0071)-gfp (pSB3K3) (Fig. 3-2-3-5-7)

B. Pcon-rhlR-ssrA (pSB6A1), Prhl(NM)(BBa_ K1949060 )-gfp (pSB3K3) (Fig. 3-2-3-5-8)
C. Pcon-rhlR-ssrA (pSB6A1), Prhl(M)-gfp (pSB3K3) (Fig. 3-2-3-5-9)
D. Pcon-rhlR-ssrA (pSB6A1), Pcon-gfp (pSB3K3) …Positive control (Fig. 3-2-3-5-10)
E. pSB6A1, pSB3K3 …Nagative control (Fig. 3-2-3-5-11)

III. Comparison the improved Prhl by iGEM 2014 Tokyo_Tech to our original improved Prhl
A. Pcon-rhlR-ssrA (pSB6A1), Prhl(LR)-gfp (pSB3K3) (Fig. 3-2-3-5-12)
B. Pcon-rhlR-ssrA (pSB6A1), Prhl(NM)-gfp (pSB3K3) (Fig. 3-2-3-5-13)
C. Pcon-rhlR-ssrA (pSB6A1), Pcon-gfp (pSB3K3) …Positive control (Fig. 3-2-3-5-14)
D. pSB6A1, pSB3K3…Negative control (Fig. 3-2-3-5-15)

-Medium
LB medium AK
LB medium containing ampicillin (50 microg/ mL) and kanamycin (50 microg/ mL)
LB medium K
LB medium containing kanamycin (50 microg/ mL)





5-2. Assay Protocol

The following experiments is performed at 37℃ unless otherwise stated.

I. Improved Prhl by iGEM 2014 Tokyo_Tech and rhlR assay

1) Prepare overnight culture for each sample in 3mL LB medium AK with vigorous shaking.

2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

3) Incubate the fresh cultures for 1 h with vigorous shaking.

4) Add C4 or DMSO to each 500 microL sample at the final concentration 10 microM or 100 microM.

5) Incubate the samples for 4 h with vigorous shaking.

6) Add 100 microL of the samples into each well of a plate reader.

7) Measure RFU of GFP / Turbidity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

8) Measure the turbidity at 600 nm.

II. Improvement the native Prhl (BBa_R0071)

1) Introduce a point mutation to -10 region of Prhl (BBa_R0071)-gfp (pSB3K3) by inverse PCR using native Prhl(BBa_R0071)-gfp (pSB3K3) as a template and divergent primers. The sequences of the six forward premiers and of one reverse primer are shown below.

WT 　 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaaaagtgttctactagtagcg-3'
F-Mu1 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggntaaaaagtgttctactagtagcg-3'
F-Mu2 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggcnaaaaagtgttctactagtagcg-3'
F-Mu3 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctnaaaagtgttctactagtagcg-3'
F-Mu4 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctanaaagtgttctactagtagcg-3'
F-Mu5 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaanaagtgttctactagtagcg-3'
F-Mu6 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaanagtgttctactagtagcg-3'
R 5'-aattcgaaagctaacggtaactgcca-3' (5’ phosphorylated)

2) Prepare strains containing the pMu1~6 plasmids containing mutated Prhl-gfp (pSB3K3).

3) Streak the transformants on an agar plate containing kanamycin (50 microg / mL) and incubate overnight.

4) Pore the LB medium K at the extent of covering the surface of the agar, and collect the colonies with a spreader. Then, incubate them in 5 mL LB medium K for 16 h with vigorous shaking.

5) Extract the plasmid, and introduce Prhl(mut)-gfp (pSB3K3) and Pcon-rhlR-ssrA to XL-1 Blue.

6) Pore 200 microL LB medium AK containing C4 (6 microM) in one well of a 96-well plate and inoculate one colony to the well. Incubate the plate for 16 h.

7) Transfer 100 microL of the culture from the above samples to another plate that is suitable for fluorescence measurement. Measure the GFP RFU of GFP / Turbidity at 490 nm as an exciting wavelength and 525 nm as an emission wavelength as well as the turbidity at 600 nm.

8) Select mutants that have higher SN ratio than native Prhl (BBa_R0071) and grow them in 3mL LB medium AK overnight with vigorous shaking.

9) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

10) Incubate the fresh cultures for 1 h with vigorous shaking.

11) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.

12) Incubate the samples for 4 h with vigorous shaking.

13) Add 100 microL of the samples into each well of a plate reader.

14) Measure RFU of GFP / Turbidity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

15) Measure the turbidity at 600 nm.


III. Comparison the improved Prhl promoter by iGEM 2014 Tokyo_Tech to our original improved Prhl promoter

1) Prepare overnight cultures for each sample in 3mL LB medium AK with vigorous shaking.

2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

3) Incubate the fresh cultures for 1 h with vigorous shaking.

4) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.

5) Incubate the samples for 4 h with vigorous shaking.

6) Add 100 microL of the samples into each well of a plate reader.

7) Measure RFU of GFP / Turbidity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

8) Measure the turbidity at 600 nm.

6. Reference

(1) Gerardo Medina et al. (2003) Mechanism of Pseudomonas aeruginosa RhlR Transcriptional Regulation of the rhlAB Promoter.
BACTERIOLOGY 185: 5976-5983

(2) John S. Chuang et al. (2009) Simpson’s Paradox in a Synthetic Microbial System.